VALUE OF CO -PEPTIN PLASMINOGEN ACTIVATOR [600436]

1
VALUE OF CO -PEPTIN/ PLASMINOGEN ACTIVATOR
INHIBITOR -1 AXIS IN EARLY DIAGNOSIS OF
PRETERM LABOR RISK AMONG PRE -ECLAMPTIC
EGYPTIAN WOMEN
Noha M. Shafik1, Soha S. Zakaria1, Ahmed M. Hagras2 and Ghada M. Abou -Fard3
Departments of Medical Biochemistry1, Gynecology2 and Physiology3, Faculty of Medicine,
Tanta University
ABSTRACT
Pre-eclampsia (PE) is a multisystem pregnancy specific disorder leading to
preterm labor risk with life -threatening complications to mother and fetus. However, the
exact molecular mechanism of propagation of preterm labor risk of PE isn't well
established . The objective of this study was to evaluate the roles of plasminogen activator
inhibitor -1 (PAI -1) and co -peptin in the pathogenesis of preterm labor of PE and their
association with oxidative stress. This study included sixty pregnant females who were
classified into tw o groups: Group І (controls) , included 30 normotensive pregnant females
and group ІІ included, 30 pre -eclamptic pregnant females which was subdivided according
to the gestational age at delivery into 15 full term PE (group ІІ a) and 15 pr eterm PE
(group ІІ b ). Co-peptin and plasminogen activator inhibitor -1 (PAI -1) placental mRNA
expressions were estimated by quantitative real time PCR and their plasma concentrations
together with oxidi zed low density lipoprotein (ox -LDL) were measured by enzyme linked
immunosorbant assays . Tissue xanthine oxidase (XO) activity was assessed by
spectrophotometry. Demographic and clinical data were recorded. Kidney function tests
were assessed. Plasma co -peptin and PAI -1 concentrations and expressions were in creased
in preterm PE group compared to term PE group and both were highe r than control group.
Meanwhile, no significant differences were found in ox -LDL levels and XO activity
among term and preterm groups, with being higher than their corresponding in co ntrol
group. It can be concluded that high levels and expressions of co -peptin and PAI -1 may
highlight their novel role in endothelial and vascular dysfunctions which may contribute
for acceleration o f pret erm labor in PE patients. Also, their combined plasma le vels may
benefit as noninvasive biomarkers for early detection of preterm labor risk among PE
patients.
Key words: Pre -eclampsia (PE); co -peptin; plasminogen activator inhibitor -1 (PAI –
1); oxidized low density lipoprotein (ox -LDL); xanthine oxida se (XO).
*Corresponding author ([anonimizat])

2
INTRODUCTION
Pre-eclampsia (PE) is a multisystem pregnancy specific disorder and is a
leading cause of maternal and fetal/neonatal mortality and morbidity worldwide .It
can be subclassified according to the gestational age at the time of delivery into;
preterm PE and term PE (Soni -Trinidad et al., 2015 ). Hypertension, proteinuria
and abnormal placenta e are involved in both types. However they show different
molecular pa thogenesis, clinical features, maternal and fetal outcomes and
biochemical markers ( (Fragkiadaki et al., 2015 ). High incidence of the life –
threatening complications as placental dysfunction, intrauterine growth restriction
and low birth weight are observed in preterm PE which occurs before 37 weeks of
gestation. In contrast, mild clinical features and favorable maternal and neonatal
outcomes are observed in term PE, which occurs after 37 weeks of gestation
(Johnson et al., 2015 ). The underlying mechanisms which finally trigger the
disease at different gestational ages are not fully understood. It is believed that PE
occur s secondary to placental chronic hypoxia induction of tissue oxidative stress
and placental apoptosis and necros is which finally leads to endothelial dysfunction
and an exaggerated inflammatory response ( Huppertz, 2014 ). Previous reports
noted that, increased levels of urinary albumin as well as serum uric acid which is a
by-product of the xanthine dehydrogenase/xan thine oxidase (XO) pathway are
predictive of preeclampsia ( Udenze et al., 2015 ). High expression levels of XO
were found in cytotrophoblast and villous stromal cells ( Murata et al., 2013 ). In
parallel, inflammation is associated with oxidative stress causing peroxidative
damage t o the vascular endothelium and low density lipoprotein oxidation (ox-
LDL) which contributes to endothelial injury and placental dysfunction in PE
(Schreurs et al., 2013 ). Co -peptin is the C terminal of provasopressin and is
derived from a pre -pro-hormone consisting of vasopressin and neurophysin II. It is
a 39-amino acid -glyco peptide which is known to be a hormone of endogenous
stress and a more reliable and stable marker than vasopressin (Dabla et al., 2011 ).
The vasopressor factor, co -peptin may regulate vascular to ne and its increased
levels could antedate clinical evidence of preeclampsia, this makes co -peptin a
promising candidate marker of PE ( Yeung et al., 2014 ). Plasminogen activator
inhibitors lead to inactivation of urokinase plasminogen activator ( uPA) which
regulates the production of plasmin , leading to reduced trophoblast invasion .
Plasminogen activator inhibitor -1 (PAI-1) was primarily found at the interface
where detachment from maternal tissue occurs (Balcı et al., 2015 ). In addition,
increased le vels of plasminogen a ctivator inhibitor -1 (PAI -1) have been recognized

3
as hallmarks of endothelial dysfunction ( Hunt et al., 2015 ). Endothelial damage
together with impaired fibrinolytic activity and disturbances in vasoconstrictor
products appeared to have crucial role in the propagation of preterm labor in PE
patients ( Anton and Brosnihan , 2008 ). Accordingly, combinations of biomarkers
may typically predict the risk of preterm labor in pre -eclamptic patients better than
a single biomarker. Therefore, the aim of the present study was to evaluate the
roles of plasminogen activator inhibitor -1 (PAI -1) and co -peptin in the
pathogenesis of preterm labor of PE and their association with oxidative stress.
MATERIALS AND METHODS
This study included sixty women selected within age range of 24 -32 years.
All participants were primipara selected from the Clinic of Obstetrics and
Gynecology Department, Tanta University Hospitals and were closely monitored
until their labor. The diagnosis of PE was based on the modified American College
of Obstetricians and Gynecologists criteria ( The American College of Obs tetrics
and Gynecology Committee on Obstetric Practice, 2002 ), which defined PE as a
blood pressure ≥ 140 mm Hg systolic (SBP) or ≥ 90 mm Hg diastolic (DBP) on
two separate readings taken at least four to six hours apart , proteinuria ≥ 500 mg/24
hours (in at least two random urine specimens collected 6 hours or more apart) and
hyperuricemia >5.5 mg/dl after 20 weeks of gestation. All participants were
subjected to complete history taking, general, and clinical examination. They were
equally classified into two groups. Group І, (control group) included 30
normotensive healthy pregnant females with gestational age at delivery ≥ 37 weeks
.They were normotensive, normoglycemic and had no pr oteinuria during
pregnancy. G roup ІІ , included, 30 PE pregnant fem ales who were identified as
having hype rtension during their pregnancy , and were subdivided according to the
gestational age at delivery into 15 term PE (group ІІ a) with gestational age at
delivery ≥ 37 weeks of gestation and 15 preterm PE (group ІІ b) w ith gestational
age at delivery ≤ 37 weeks of gestation, whether delivery was medically indicated
or spontaneous ly which included those with spontaneous onset of labor and those
with preterm pre -labor rupture of membranes. All participants were non -diabeti c
with normal glucose tolerance test.
Exclusion criteria : (for both PE Subjects and controls):
Women with history of hypertension, multiple gestations, hyperandrogenism,
polycystic ovarian disease, chronic corticosteroid drug use, hormonal treatment,
kidney disease, chronic liver disease, smoking and any autoimmune disease were
excluded from the study.

4
Informed written consent was obtained from all participants. The study
protocol was approved by the Local Research Ethics Committee , Tanta University
and was in accordance with the principles of the Declaration of Helsinki II.
Chemicals : ALL chemicals were purchased from Sigma (Sigma, St Louis,
USA) .
Urine sampling: Urine samples were collected in sterile containers from all
women who were between the 25th and 30th weeks of gestation for 24 hours protein
content.
Blood sampling: Venous blood sampling (10 ml in vacutainer tubes) was
obtained from all participants who were between the 25th and 30th weeks of
gestation, by puncture of an ante -cubital vein at 8 a.m. after an overnight fasting.
Sample was divided into two aliquots, one aliquot, transferred slowly to dry sterile
centrifuge tube, allowed to clot at room temperature, centrifuged at 2000 xg for 10
minutes for serum separation and stored at -70 ș C until the time of analysis of
kidney function tests. The second, transferred to vacutainer tubes coated with
ethylene diamine tetra acetic acid (EDTA) , centrifuged at 2,500 xg for 10 min. for
plasma separation and stored at −40◦C until the time of analysis of levels of ox –
LDL, plasminogen activator inhibitor -1 and co -peptin.
Tissue sampling : Placental tissues were obtained immediately after delivery
from all participants aft er cesarean section or normal labor. After manual stripping
of the amnion from the placental tissues, placental specimens were washed briefly
with ice cold saline to remove excess blood and were cut into pieces (about 2 cm2
each) that were divided into ano ther 2 pieces: one piece was fixed in 10% formalin
and embedded in paraffin for histopathological studies and the other was stored at –
80 ˚C till use for tissue homogenization and estimation of mRNA expression of co –
peptin and PAI -1.
Placental homogenate preparation: Placentae were washed with sali ne
solution. Pieces of placentae were weighted and homogenized with a Potter –
Elvenhjem tissue homogenizer (20 -30 up and down strokes) in 1 ml lysis buffer
which was composed of 0.05 mol/litre (hydroxymethyl) ami nomethane
hydrochlori de, pH 6.8, 0.2 mmol/litre EDTA ,100g/ litre sucrose and 1.5 g/litre Na
Azide ( Keelan et al., 1999 ).The homogenate s were taken and centrifuged for 7
minutes at 10,000 xg; the resultant supernatants were stored frozen at -80 ˚C till
biochemical analysis . Protein content was measured according to the method of
Bradford for quantitative estimation of proteins ( Bradford, 1976 ).

5
Laboratory investigations:
Both groups were subjected to the following:
1- Kidney function tests: including serum urea and creatinine according to Chaney
and Marbach, 1962 and Weber and Van Zanten, 1991 , respectively.
2- Serum uric acid: by colorimetric methods, as described by Sagen et al., 1984.
3- 24 hours urinary proteins were estimated by assay kit obtained from Spinreact.
Briefly, protein reacted in acid solution with pyrogallol red and molybdate to form
a colored complex. The intensity of the color formed was proportional to the
protein concentration in the sample which was r ead by spectrophotometry at 405
nm (Orsonneau et al., 1989 ).
4- Plasma levels of co -peptin: by enzyme linked immunosorbant assay ( ELISA ) Kit
(Cat# EP1100 -5, Assay Max, USA) according to manufacturer's instructions
(Tuten et al., 2015 ).
5- Plasma levels of PAI -1: by ELISA kit (Cat#SEA365Hu Cloud C one Corp, USCN
Life Science Inc , Houston, USA) according to manufacturer's instructions ( Bodova
et al., 2011 ).
6- Plasma ox -LDL levels: by ELISA kit (Cat # STA -369, OxiSelect ™ Human
Oxidized LDL ( Malonialdehyde -low density lipoprotein (MDA -LDL)
Quantitation, USA), according to manufacturer's instructions ( Açıkgöz et al.,
2013).
7- Estimation of xanthine oxidase activity in tissue homogenates: Xanthine oxidase
activity was assayed using xanthine as a substrate (0.0001 M). Xanthine was
oxidized to uric acid at pH 6.8 by xanthine oxidase enzyme as following:
Xanthine x.o uric acid
Enzyme activity was measured via the increase in the absorbance at 290 nm caused
by oxidation of xanthine to uric acid. The enzyme activity was expressed as (U/mg
protein) where Unit equals: micromolar of uric acid produced per minute
(Hideharu, 2013 ).
8- Estimation of mRNA expressions of plasminogen activator inhibitor -1 and co –
peptin in placental tissues by quanti tative real -time PCR.
RNA extraction, cDNA synthesis and real time PCR:
i) RNA extraction:
Total RNA was extracted from placental tissue homogenates according to the
protocol of the Qiagen RNeasy Mini Kit. RNA was eluted and its concentration
was measured spectrophotometrically at 280 nm and then stored at -80°C.

6
ii) cDNA synthesis :
cDNA synthesis was performed using the RevertAid H Minus First Strand cDNA
Synthesis kit (# K 1632Thermo Scientific Fermentas, St. Leon -Ro, Germany)
according to the manufacturer’s instructions.
iii) Real -time quantitative PCR :
Real-time PCR was carried out with single stranded cDNAs. PCR reactions
were performed using Power SYBR Green PCR Master Mix following
manufacturer's instructions and 7500 Fast Real -Time PCR System (Applied
Biosystems, CA, USA). PALI -1 and co -peptin mRNA transcripts were quantified,
relativ e to the house -keeping gene; (GAPDH) . Sequence specific primers of PAI –
1, co-peptin and GAPDH were as follows, respectively: PAI-1: forward: 5’ –
ATCCTGCCTAAGTTCTCTCTG -3’, PAI -1: reverse: 5’ –
ATTGTCTCTGTCGGGTTGTG -3’ (NCBI accession No., M33960). Co-pepti n:
forward: 5' -TATTAAAGTCAGAGAGAACGTAA -3', co -peptin: reverse: 5' –
GTGCAGCTGTTAAAGTTTGAGAGATGTATT -3'. (NCBI accession No.,
NP_000482.1). GAPDH: forward: 5′ – CTCCCATTCTTCCACCTTTG -3′,
GAPDH: reverse: 5′ – CTTGCTCTCAGTATCCTTGC -3′ (NCBI accession No.,
XR_145951 .1). Different numbers of cycles were run to ensure that amplification
of all fragments were within the linear range of the PCR. For PAI -1, an initial
denaturation at 95°C for 2 min was followed by 35 cycles with 94°C for 45 s
(denaturation), 58°C for 1 m in (annealing), 72°C for 1 min (extension). For co –
peptin, an initial denaturation at 95°C for 10 min (1 cycle), followed by 40 cycles
with 94°C for 15 s (denaturation), 58°C for 1 min (annealing) and 60°C for 1 min
(extension). The determination of the re lative levels of gene expression was
performed using the cycle threshold )ΔΔCt (method and normalized to the
housekeeping gene GAPDH, which was not altered by the experimental conditions.
Statistical Analysis
The data were analyzed using statistical packa ge for the social science
(SPSS) version 20.0 software (SPSS Inc., Chicago, IL, USA). Quantitative data
expressed as mean and standard deviation. Categorical variables were compared
using Chi -square test. Multiple comparisons were performed by one -way anal ysis
of variance (ANOVA) followed by Tukey’s post -hoc test. Receiver operating
characteristics (ROC) analysis was used to identify the optimal threshold values of
the studied parameters. Correlations were analyzed using the Pearson test .

7
RESULTS
A statistical comparison between the studied groups with respect to the age
and diagnostic data using ANOVA test followed by Tukey’s post -hoc test
demonstrated in Table (1). No statistically significant differences were detected
between the studied groups regarding age (years) and weight (Kg) (p>0.05). SBP
and DBP (mm/Hg) were higher in PE groups (ІІ a and ІІ b) a s compared to the
control group (p<0.001). The gestational age at delivery (weeks) was significantly
lower in pr eterm PE group than in term PE and in both PE groups, it w as lower
than the control group (p<0.001 ). As regards birth weight at delivery (gram ), it was
significantly lower in preterm PE group than in term PE and in both PE groups, it
was lower than in the control group (p<0.001). However, no significant
correlations were found between group І Іa and group ІІb regarding SBP and DBP.
Also, in table (2), total proteins in urine (mg/24h ), blood urea (mg/dl ) and
creatinine (mg/dl ) and serum uric acid (mg/dl ) were significantly high er in PE
groups (ІІ a and ІІ b) than in control group (p<0.001). However, no significant
correlations were found between group ІІa and group ІІb regarding urinary total
proteins, blood urea and creatinine and serum uric acid.
In table (3), regarding, co-peptin, its plasma levels and mRNA tissue
expressions, were significantly higher in preterm PE group (ІІ b) (117.65±10.7
pg/ml and 1.02±0.32 respectively) than in term PE group (ІІ a) (109.6± 8.6 pg/ml,
and 0.74±0.25, respectively) and both were higher than in the control group
(100.35± 9.5 pg/ml and 0.15±0.09 respectively), (p<0.001). Also, PAI -1 plasma
levels and mRNA tissue expressions were significantly higher in preterm PE group
(ІІ b) (113.98±10.28 ng/ml and1.09±0.26 respectively) than in term PE group (ІІ a)
(102.78± 9.50 ng/ml, and 0.73±0.14, respectively) and both were higher than in the
control group (70.04± 7.42 ng/ml and 0.29±0.06 respectively). Plasma ox -LDL
levels (ng/ml) and tissue XO activity (U/mg protein ) were significantly high er in
PE groups (ІІ a and ІІ b) than their cor responding in the control group (p<0.001).
However, no significant correlations were found between group ІІa and group ІІb
regarding plasma ox -LDL levels and tissue XO activity.
In table (4 ), Receiver operating chara cteristics (ROC) analysis was used to
assess t he diagnostic value of the plasma co-peptin and PAI -1 in preterm labor as
well as to identify their optimal cut off values . The optimal cut off value of plasma
co-peptin was 120.63 pg/ml, the sensitivity at thi s cut off point was 95.4%, the
specificity was 94.3%, the positive predictive value was 97.1 and the negative
predictive value was 92.6 and the accuracy was 94.0. The optimal cut off value of

8
plasma PAI-1was 110.47 ng/ml, the sensitivity at this cut off point was 94.8%,
specificity was 91.1%, positive predictive value was 90.2 %, negative predictive
value was 89.9%, and an accuracy of 90.0.
In table (5 ), by using Pearson correlation test, in preterm PE group, co -peptin
and PAI -1 plasma levels and expressions showed positive correlations with each
other's and with SBP, DBP , as well as with levels of ox -LDL and uric acid, XO
activity and blood urea and creatinine . However, co -peptin and PAI -1 plasma
levels and expressions showed significant negative correlations with gestational
age at delivery and birth weight at delivery (p <0.05) .
Histopathological examination:
The results of histopatho logical examination of placentae of normotensive
women (group I), showed small delicate villi covered with thin trophoblastic lining
as shown in (figure 1). However, the placentae of full term PE women (group IIa)
showed, impaired remodeling in the form of fibrotic villi (figure 2) and o f preterm
PE (group IIb) showed, deposition of large fibrinous material in the core of the villi
and thickening of their blood vessels due to concentric fibrosis (figure 3).
Table 1: Clinical and demographic data in selected cases
Variables Group І
(n=30) Group ІIa
(n=15) Group ІIb
(n=15)
Age (years) 28.2±2.3 27.5±3.1 28.6±2.8
SBP (mm/Hg) 122.4 ±7.3 154.0 ±9.4 a 157.0 ±10.2 a
DBP (mm/Hg) 74.8±11.6 98.0±14.8 a 98.5±13.2 a
Weight (kg) 70.1±6.7 72.5±8.2 72.6±4.3
Gestational age at delivery
(weeks) 38.5±1.4 37.4±0.4 a,b 35.1±1.4 a,b
Birth weight at delivery (gram) 3592.3±367.6 3226.0±284.5a,b 2274.5±165.1 a,b
Group І: control group. Group ІІ a: term PE. Group ІІ b: preterm PE. Results are expressed as mean
values ± S.D. P was considered significant at P< 0.05. a significant difference with control; b
significant difference between term and preterm PE groups. SBP: systolic blood pressure; DBP:
diastolic blood pressure.
Table 2: Diagnostic data in selected cases
Vriables Group І
(n=30) Group ІIa
(n=15) Group ІIb
(n=15)
Total protein in urine (mg/24h) 137.15 ±15.4 2321.60 ±553.7 a 2344.50 ±557.8 a
Blood urea (mg/dl) 29.60 ±3.2 48.20 ±8.7 a 49.20 ±7.4 a
Serum creatinine (mg/dl) 0.75±0.06 1.08±0.09 a 1.14±0.08 a
Serum uric acid (mg/dl) 3.14±0.85 5.84±1.23 a 5.83±1.54 a
Group І: control group. Group ІІ a: term PE. Group ІІ b: preterm PE. Results are expressed as mean
values ± S.D. P was considered significant at P<0.05. a significant difference with control group.

9
Table 3: Laboratory investigations of the studied parameters in preeclamptic
patients and healthy controls.
Variables Group І
(n=30) Group ІIa
(n=15) Group ІIb
(n=15)
Plasma co -peptin levels (pg/ml) 100.35 ±9.5 109.6 ±8.6 a,b 117.65 ±10.7 a,b
Co-peptin mRNA/ GAPDH mRNA
ratio 0.15±0.09 0.74±0.25 a,b 1.02±0.32 a,b
Plasma PAI-1 levels
(ng/ml) 70.04 ±7.42 102.78 ±9.50 a,b 113.98 ±10.28
a,b
PAI-1 mRNA/ GAPDH mRNA ratio 0.29±0.06 0.73±0.14 a,b 1.09±0.26 a,b
Plasma ox – LDL levels
(ng/ml)
77.45 ±6.84
151.79 ±14.62 a
151.87 ±15.90a
Tissue XO activity (U/mg protein ) 1.84±0.36 3.85±1.02 a 3.98±1.12 a
Group І: control group. Group ІІ a: term PE. Group ІІ b: preterm PE. Results are expressed as mean
values ± S.D. P was considered significant at <0.05; a significant difference with controls; b
significant difference between term and preterm PE groups. PAI -1: plasminogen activator inhibitor –
1; ox – LDL: oxidized low density lipoprotein; XO: xanthine oxidase.
Table 4 : The performance characteristics for plasma co -peptin and PAI -1
levels in prete rm PE group.
Variables Cutoff Sensitivity Specificity PPV NPV Accuracy
Plasma co -peptin
(pg/ml ) > 120.63 95.4% 94.3% 97.1% 92.6% 94.0
Plasma PAI –
1(ng/ml) > 110.47 94.8% 91.1% 90.2% 89.9% 90.0
PPV: positive predictive value, NPV: neg ative predictive value, PAI -1: plasminogen activator
inhibitor -1.
Table 5 : Correlation analysis between the different studied variables in
preterm PE patients.
Variables Plasma
co-peptin
(pg/ml ) Co-peptin
mRNA
expression Plasma
PAI-1
(ng/ml) PAI-1 mRNA
expression
r r r r
Co-peptin mRNA expression 3.527*
Plasma PAI-1(ng/ml) 12.642* 3.071*
PAI-1 mRNA expression 10.028* 2.896* 10.672*
SBP (mm/Hg ) 4.724* 2.508* 3.751* 15.972*
DBP (mm/Hg) 2.065* 7.652* 4.976* 3.681*
Gestational age at delivery
(weeks) -2.524* -2.920* -6.883* -2.913*
Birth weight at delivery (gram) -3.077* -4.987* -3.200* -5.671*
Total proteins in urine (mg/24
h) 8.044* 5.626* 7.508* 8.297*
Blood urea (mg/dl) 2.935* 4.568* 2.675* 14.682*
Serum creatinine (mg/dl) 3.675* 7.921* 2.015* 3.567*
Serum uric acid (mg/dl) 2.990* 11.891* 6.087* 2.874*
Tissue XO activity (U/mg
protein) 3.387* 5.674* 3.677* 3.075*
Plasma ox -LDL (ng/ml) 7.681* 7.653* 4.528* 8.359*
r= Pearson’s correlation coefficient, *Significance at p <0.05 . SBP: systolic blood pressure; DBP:
diastolic blood pressure, PAI -1: plasminogen activator inhibitor -1; XO: xanthine oxidase; ox -LDL:
oxidized low density lipoprotein .

10

Figure 1: High power view of full term placenta of normotensive woman (H&E; ×400)

Figure 2: Photomicrograph from term Figure 3 : Photomicrograph from preterm
PE Placenta (H&E; ×400) PE placenta (H&E; ×400)

DISCUSSION
Gestational hypertension –preeclampsia is the most common medical disorder
of pregnancy. It is of great need to figure out the pathogenesis of preterm labor
associated with PE and further exploration of potential biomarkers that may allow
the identification of a group of patients requiring increased fetal survei llance. The
adverse effects of pre -eclampsia are confirmed in the present study by the assessed
biomarkers, including, hyperuricemia which represented early signs of renal
dysfunction ( Giorgi et al., 2015 ) with significant increase of proteinuria, blood
urea and creatinine in both PE groups compared to control group. These results
were confirmed by the i ncreased activity of XO which may be a result of oxidative
stress that plays an important key role in tissue damage in the human placenta
(Bainbridge and Ro berts, 2008 ). There are several mechanisms leading to
hyperuricemia and increased oxidative stress in PE including , hypoxic maternal –
fetal interface, increased turnover of trophoblast tissue and shallow i mplantation
are characteristics of PE which produce higher levels of circulating
cytokines, xanthine and hypoxanthine concentrations ( Murata et al .,2013 ). These
altered biochemical markers may have important role in hypertension observed in
PE. Noteworthy, in the current study, the observed high PAI -1 plasm a and
placental mRNA expressi on levels in PE groups with highe r levels in preterm

11
group may be the cause of vascular disease progressio n. Increased levels of PAI -1
in PE may be attributed to stimulation of proinflammatory cytokines and oxidative
stress generated from NADP H oxidase and xanthine oxidase , which may induce
plasminogen activator inhibitor -1 (PAI -1) production by microvascular endothelial
cells (Shu et al., 2014 ). In line with the current study, Prochazka et al. (2015) ,
who stated that, increased release of antifibrinolytic factors from the placental
syncytium into maternal blood promoted maternal endothelium dysfunction
complicated with intrauterine growth restriction (IUGR).The vasoconstrictor
efficacy of co -peptin whic h coincides with early response to endothelial damage is
derived mainly from endothelial cells and attributed to its action as a local stress
hormone ( Dabla et al., 2011 ). Given that, in the current study, the increased levels
and mRNA expression of co -peptin in preterm PE group than in term PE group,
with both being higher than control group is a strong evidence of its role in PE
pathogenesis. These results are confirmed by the results of Foda and Abdel Aal
(2013) who concluded that, maternal co -peptin levels may be a reliable marker for
fetal growth restriction in PE . Furthermore, the observed significant differen ces in
co-peptin and PAI -1 levels between patients who subsequently developed preterm
and term preeclampsia herein, had important clinical implication in detecting
pregnant women at high risk of preterm delivery . In the current study, there were
increased levels of the oxidative stress marker s, ox-LDL in both term and preterm
PE groups . Oxidation of LDL secondary to oxidative stress and trans formation of
monocytes into foam cells following the uptake of oxLDL are significant steps
towards endothelial dysfunction ( Yavuzcan et al., 2014 ). Increased levels of ox –
LDL also, can reduce available LDL and down regulate endothelial nitric oxide
synthas e (e-NOS), restricting vasodilatation which in turn increasing vascular
damage (Zuniga et al., 2014) . Also, Schreurs et al. (2013) revealed a new
mechanism for blood brain barrier disruption in PE by ox -LDL/ lectin -like
oxidized L DL receptor -1 (oxLDL/LOX -1) activation and subsequent peroxynitrite
generation leading to vascular dysfunction. It is to be noted that, ox -LDL activates
the endothelium to secrete chemokines which recruit inflammatory cells and
markedly enhances PAI -1 expression ( Zhang et al., 2010 ). The influence of these
pathomechanisms could involve impaired fetal amino acid transplacental transport
which ultimately affects fetal growth (Ergaz et al., 2005) , as confirm ed in the
present study b y the low birth weight fetus of preterm pr e-eclamptic women .
Nevertheless, our data reported positive correlations between co -peptin and PAI -1

12
with each other and with oxidative stress . Collectively, co-peptin and PAI -1 were
significantly associated with preterm labor of PE.
In conclusion : High levels and expressions of co -peptin and PAI -1 may highlight
their novel role in endothelial and vascular dysfunctions which may contribute for
acceleration of preterm labor in PE patients. Also, their combined plasma levels
may benefit as noninvasive bioma rkers for early detection of preterm labor risk
among PE patients. Further studies should be performed to investigate the role of
other factors acting in spiral artery atherosis and multifactorial endothelial
dysfunction .
Recommendation: The present study recommends that, monitoring the co –
peptin/PAI -1 levels could give pre-eclamptic women at increased risk of preterm
labor the advantage of receiving steroids therapy for fetal lung maturity, thus,
reduces neonatal mortality.
Acknowledgement:
We would like to acknowledge Dr, Rania El Sayed Wasfy , assistant professor
of Pathology, Faculty of Medicine, Tanta University, for her help in the
histopathology in this work.
REFERENCES
Açıkgöz S , Bayar UO , Can M , Güven B , Mungan G, Doğ an S, Sümbüloğlu V.
(2013): Levels of oxidized LDL, estrogens, and progesterone in placenta tissues
and serum paraoxonase activity in preeclampsia. Mediators Inflam m. 2013:862982.
Anton L and Brosnihan KB. (2008) : Systemic and uteroplacental renin –
angiotensin system in normal and pre -eclamptic pregnancies. Ther Adv Cardiovasc
Dis. 2(5): 349 –362.
Bainbridge SA and Roberts JM . (2008): Uric acid as a pathogenic factor in
preeclampsia . Placenta. 29:S67 -72.
Balcı Ekmekçi Ö , Ekmekçi H , Güngör Z , Tüten A , Toprak MS , Korkmaz
M, Öncül M , Çalıșkan O , Kucur M , Donma O , Madazlı R , Sönmez H . (2015):
Evaluation of Lp -PLA2 mass, vitronectin and PAI -1 activity levels in patients with
preeclampsia. Arch Gynecol Obstet. 292:53 -8.
Bodova KB, Biringer K, Dokus K, Ivankova J, Stasko J, Danko J. (2011):
Fibronectin, plasminogen activator inhibitor type 1 (PAI -1) and uterine artery
Doppler velocimetry as markers of preeclampsia. Dis Markers. 30:191 -6.

13
Bradford MM. (1976): A rapid and se nsitive for quantitation of microgram
quantities of protein utilizing the principle of protein -dye binding. Ann Biochem.
72: 248 -54.
Chaney AL and Marbach EP. (1962): Modified reagents for determination of urea
and ammonia. Clin Chem. 8: 130 -2.
Dabla PK , Dabla V , Arora S . (2011): Co-peptin: Role as a novel biomarker in
clinical practice. Clin Chim Acta. 412:22 -8.
Ergaz Z , Avgil M , Ornoy A . (2005): Intrauterine growth restriction
etiology and consequences: what do we know about the human situation and
experimental animal models? Reprod Toxicol. 20:301 -22.
Foda AA and Abdel Aal IA. (2013): Maternal serum co -peptin as a marker for
fetal growth restriction. Middle East Fertility Society Journal.18: 159 -164.
Fragkiadaki P, Soulitzis N, Sifakis S, Koutroulakis D, Gourvas V , Vrachnis
N, Spandidos DA . (2015): Downregulation of notch signaling pathway in late
preterm and term placentas from pregnancies complicated by preeclampsia. PLoS
One. 11:10 -e0126163.
Giorgi VS, Borges VT, Witkin SS, Bannwart -Castro CF, Peracoli JC, Peracoli
MT. (2015): [190-POS]: Association between adenosine deaminase, uric acid and
inflammatory cytokines in women with preeclampsia. Pregnancy Hypertens .5:96 –
7.
Hideharu S hintani. (2013): Determination of Xanthine Oxidase. Pharm Anal
Acta. S7:004.
Hunt KJ , Baker NL , Cleary PA , Klein R , Virella G , Lopes -Virella MF . (2015):
Longitudinal association between endothelial dysfunction, inflammation, and
clotting biomarkers with subclinic al atherosclerosis in type 1 diabetes: An
Evaluation of the DCCT/EDIC Cohort. Diabetes Care. 38:1281 -9.
Huppertz B . (2014): Maternal and fetal factors and placentation: implications for
pre-eclampsia. Pregnancy Hypertens. 4:244.
Johnson A , Federico C , Martinez M , Tran KA , Kao E, Hooshvar N, Tice D, Wu
G, Gambala C, Pridjian G, Dola C. (2015): [192-POS]: Term and pre term
preeclampsia: Are there two distinct phenotypes? Pregnancy Hypertens . 5:97.
Keelan JA, Marvin KW, Sato TA, Coleman M, McCowan LM , Mitchell MD .
(1999): Cytokine abundance in placental tissues: evidence of inflammatory
activation in gestational membranes with term and preterm parturition. Am J
Obstet Gynecol. 181: 1530 -6.

14
Murata M , Fukushima K , Takao T , Seki H , Takeda S , Wake N . (2013):
Oxidative stress produced by xanthine oxidase induces apoptosis in human
extravillous trophoblast cells. J Reprod Dev.59:7 -13.
Orsonneau JL, Douet P, Massoubre C, Lustenberger P, et al. (1989): An
improved pyrogallol red -molybdate method for determining total urinary protein.
Clin Chem. 35: 2233 -6.
Prochazka M, Procházková J, Lubušký M, Pilka R, Úlehlová J , Mich alec
I, Polák P , Kacerovský M , Slavik L . (2015): Markers of endothelial activation in
preeclampsia. Clin Lab. 61:39 -46.
Sagen N, Haram K, Nielsen ST. (1984): Serum urate as a predictor of fetal
outcome in severe pre -eclampsia. Acta Obstet Gynecol Scand. 63:71 -75.
Schreurs MP , Hubel CA , Bernstein IM , Jeyabalan A , Cipolla MJ . (2013):
Increased oxidized low -density lipoprotein causes blood -brain barrier disruption in
early -onset preeclampsia through LOX -1. FASEB J .27:1254 -63.
Shu C , Liu Z , Cui L , Wei C , Wang S, Tang JJ, Cui M, Lian G, Li W, Liu X, Xu
H, Jiang J, Lee P, Zhang DY, He J, Ye F. (2014): Protein profiling of
preeclampsia placental t issues. PLoS One.13;9:e112890.
Soni -Trinidad C , Gutiérrez A , Santa Rosa -Moreno FJ , Reyes -Aguilar A . (2015):
Maternal morbidity and mortality and risk factors related to an obstetric
emergency . Ginecol Obstet Mex . 83: 96 -103.
Tuten A , Oncul M , Kucur M , Imamoglu M , Ekmekci OB, Acıkgoz AS, Cebe FS,
Yesilbas C, Madazlı R. (2015): Maternal serum copeptin concentrations in early –
and late -onset pre-eclampsia. Taiwan J Obstet Gynecol. 54:350 -4.
The American College of Obstetrics and Gynecology Committee on Obstetric
Practice . (2002): American College of Obstetrics and Gynecology practice
bulletin. Diagnosis and management of preeclampsia and eclampsia. International
Journal of Gynecology and Obstetrics.77: 67 -75.
Udenze I , Amadi C , Awolola N , Makwe CC . (2015): The role of cytokines as
inflammatory mediators in preeclampsia. Pan Afr Med J . 20:219.
Weber JA and Van Zanten AP. (1991): Interferences in current methods for
measurements of creatinine. Clin Chem. 37:695 -700.
Yavuzcan A, Cağlar M, Ustün Y, Dilbaz S, Ozdemir I, Yildiz E, Ozbilgeç S,
Kumru S. (2014): Mean platelet volume, neutrop hil-lymphocyte ratio and platelet –
lymphocyte ratio in severe preeclampsia. Ginekol Pol.85:197 -203.

15
Yeung EH , Liu A , Mills JL , Zhang C , Männistö T, Lu Z, Tsai MY, Mendola P.
(2014): Increased levels of copeptin before clinical diagnosis of preelcampsia.
Hypertension. 64:1362 -7.
Zhang J, Defelice AF, Hanig JP, Colatsky T . (2010): Biomarkers of endothelial
cell activation serve as potential surrogate markers for drug -induced vascular
injury. Toxicol Pathol. 38:856 -71.
Zuniga FA , Ormazabal V , Gutierrez N , Aguilera V , Radojkovic C, Veas C,
Escudero C, Lamperti L, Aguayo C. (2014): Role of lectin -like oxidized low
density lipoprotein -1 in fetoplacental vascular dysfunction in preeclampsia.
Biomed Res Int. 2014:3536.

16
الملخص العربي
قيمة محور الكوبيبتين و مانع منشط البالزمينوجين-1 فى التشخيص المبكر لخطر الوالدة المبكرة فى تسمم
الحمل عند المصريات
نهى محمد شفيق1 , سها سعيد زكريا1 , أحمدمحمود هجرس2, غادة أبو فرد3
أقسام الكيمياء الحيوية الطبية1, النساء والوالدة 2 و الفسيولوجى 3
إن تسمم الحمل هواضطراب حمل معين ومتعدد األنظمة مما يؤدى إلى خطر الوالدة المبكرة مع
مضاعفات تهدد حياة األم والجنين. و مع ذلك لم يتم تأسيس اآللية الجزيئية المؤدية إلى انتشار خطر الوالدة
المبكرة من تسمم الحمل جيدا.و كان الهدف من هذه الدراسة هو تقييم أدوار الكوبيبتين ومانع من شط
البالزمينوجين-1 .في التسبب في خطر الوالدة المبكرة مع تسمم الحمل و ارتباطهما مع األكسدة وشملت
هذه الدراسة ستين من اإلناث الحوامل الالتي تم تصنيفهن إلى مجموعتين : مجموعة 1 ، (المجموعة
الضابطة) و شملت 30 من اإلناث الحوامل ذوات ضغط الدم الطبيعي و مجموعة2 وشملت 30 من اإلناث
ذوات تسمم حمل والتي تم تقسيمها وفقا لعمر الحمل عند الوالدة إلى 15 والدة كاملة (مجموعة2 أ) و15
والدة مبكرة (مجموعة 2 .)ب تم تسجيل البيانات الديموغرافية والسريرية و تم تقييم اختبارات وظائف
الكلى.و قد تم تقييم تعبيرات mRNA المشيمية لكل من الكوبيبتين ومانع منشط البالزمينوجين -1 بواسطة
تقنية تفاعل البلمرة التسلسلى شبة الكمى و قد تم قياس مستويات البالزما من الكوبيبتين ومانع منشط
البالزمينوجين -1 و كذلك من أكسدة البروتين الدهني منخفض الكثافة بواسطة تقنية األليزا. وتم قياس النشاط
الطيفى للزانثين اوكسييديز. و قد وجد أن مستويات البالزما و أيضا التعبير الجزيئي لكل من الكوبيبتين
ومانع منشط البالزمينوجين- 1 كانت أعلى فى حاالت الوالدة المبكرة من حاالت الوالدة الكاملة مع تسمم
الحمل و كلتا المجموعتين كانتا أعلى من المجموعة الضابطة. و فى الوقت نفسه لم تكن هناك تغييرات ذات
دالالت إحصائية في مستويات أكسدة البروتين الدهني منخفض الكثافة و نشاط الزانثين اوكسييديز من بين
مجموعتي الوالدة المبكرة والوالدة الكاملة مع تسمم الحمل , مع كونها أعلى من الذي يقابلها في المجموعة
الضابطة. لوحظ ارتباط إيجابي بين الكوبيبتين ومانع منشط البالزمينوجين -1 مع بعضهم البعض وأيضا مع
ضغط الدم، األكسدة والفشل الكلوي في مجموعة الوالدة المبكرة مع تسمم الحمل . يمكن االستنتاج أن
المستويات والتعابير العالية للكوبيبتين ومانع منشط البالزمينوجين-1 قد تسلط الضوء على دورهم الجديد في
اختالالت البطانية واألوعية الدموية التي يمكن أن تسهم في تسريع الوالدة المبكرة في المرضى الذين يعانون
من تسمم الحمل و أيضا ،مستويات البالزما المجتمعة لهم قد تفيد كمؤشرات حيوية غير مجتاحة من شأنها
تحديد خطر اإلصابة بالوالدة المبكرة بين مرضى تسمم الحمل.