Transplantation of InsulinSecreting Clusters Generated From [600461]

1 
 Title page 
Transplantation  of Insulin‐Secreting  Clusters Generated  From 
Mesenchymal  Stem Cells To Control Induced Diabetes In Rats 
Mohammad   El‐Nablaway(1) , Ahmed Emam(3), Naglaa Mokhtar(1), Osama El‐Baz(2),Raymonde  Assaf (1) , 
and Amina Baiomy (1). 
    (1) Medical Biochemistry  Department,  (2) Clinical Pathology  Department,  (3) Medical       
Experimental  Research Center (MERC), Faculty of Medicine,  Mansoura  University.  
Corresponding author: Moha mmed Helmy El-Nabalway
Address:Medical Biochemistry Departme nt, Faculty of Medicine – Mansoura
University.
E-mail: [anonimizat]  . 
Tel.:01200378699 .

2 
 Transplantation of Insulin-Sec reting Clusters Generated From
Mesenchymal Stem Cells To Control Induced Diabetes In Rats
Mohammad   El‐Nablaway(1) , Ahmed Emam(3), Naglaa Mokhtar(1),Osama El‐Baz(2),Raymonde  Assaf (1) , 
and Amina Baiomy (1). 
 (1) Medical BiochemistryDepartment,  (2)Clinical  Pathology  Department,  (3) 
MedicalExperimental  Research Center (MERC), Faculty of Medicine,  Mansoura  University.  
Diabetes mellitus (D.M) is a dise ase with high and incr easing prevalence. Insulin-producing cells
(IPCs) generated from mesenchymal stem cells (MSCs) have shown immense potential for
therapy.This study aimed to compare the differen tiation potential of MSCs obtained from human
bone marrow (BM), and umbilical cord blood (UCB) into IPCs and their therapeutic efficiency
to control streptozotocin (STZ) –induced diabetic rats. MSCs were isolated from human BM and
UCB, expanded and differentiate d to IPCs. The Cells were ev aluated by flow cytometry for
MSCs markers, RT-PCR for insulin gene expressi on and ELISA detection of c-peptide release.
IPCS were transplanted into the liver of diabet ic rats and then evaluated by weekly measurement
of the fasting blood glucose (FBG) levels, and detection of in vivo release of c-peptide. This
study demonstrated that FBG levels of transplanted diabetic rats were significantly lower than
non-transplanted, but in diabetic rats transp lanted with IPCs derived from UCB-MSCs were
significantly lower than transplanted with IPCs derived from BM-MSCs. The level of c-peptide
released from transplanted IPCs derived fr om BM-MSCs and UCB-MSCs was non-significantly
different.The results indicate that UCB- MSCs and BM-MSCs are promising stem cell sources
forIPCsthat help in the development of a new strategy for treatment of D.M.
Introduction:
DM is among the most frequent chronic and metabolic disorders (Shaw et al., 2010) . The
number of people who have DM worldwide has doubled during the past three decades (Chen L et 
al.,2011). In 2010, around 285 million people worldwide had DM, and the number rises to 439
million by 2030 (Zhu et al., 2017). DM can be simply classified into type 1 (T1DM) and type 2
(T2DM) (Yiet al., 2016). T1DM is characterized by the insufficiency of β-cells as a consequence
of autoimmune destruction .There aremany therapeutic strategies for TIDM includinginsulin

3 
 injection, and pancreas or islet transplantation .Insulin injection mimics β-cell function, but does
not match the precision of functioning β-cells (Lilly et al.,2016).  Islet transplantation has
developed to be a possible thera py for T1DM, but is clinically limited due to lack of donors and
immune rejection (Yang et al.,2017) . Stem cells having the capac ity to differentiate into
IPCsturn it into promising treatment for TIDM (Mishra et al., 2010) .
Numerous studies have revealed that embryonic stem cells (ESC s), Induced pluripotent stem
cells (iPSC), and MSCs are able to differentiate into IPCs (Chandra  et al., 2011) .ESCspossesthe
highest differentiation potential to IPCs. However, they have the prospect tocreate benign cystic
teratoma and possible destruction of embryos along the way of collection (El-Badri and
Ghoneim., 2013). The application of iPS faces many ch allenges since the high tumorigenic
potential of direct reprogramm ing caused by genome integrati on and activation of oncogene c-
Myc.MSCs have already been employed in seve ral therapeutic applications as therapy for
TIDMbecause of their immunomodulatory proper ties,low immunogenicity as a result oflack
ofmajor histocompatibility complex II( MHC II), and minimal oncogenic risk (Lilly et
al.,2016). MSCs areoriginated from a diversevariety of tissues as BM,UCB, peripheral blood,
adipose tissue, and trabecular bone (Trivanovi ć et al.,2013). MSCs derived from BM, adipose
tissue, UCB, Wharton jelly, and placenta were chosen for differentiation into
IPCs (Hashemianetal.,2015). Various studiesdeclare that the gene ration IPCs from stem cells is
achievable and promising. However, with regard to a wide variety ofthe differentiation protocols
and the originof stem cell might be a challenge for researchers. A precise selection of stem cell
source and differentiation protocol is needed for a successful IPC generation (Khorsandi et al.,
2015) .
Materials and methods:
This study is a Randomized Controlled Trial (RCT), was done in Medical Biochemistry
Department and MERC, Faculty of Medicine,Mansoura University.
Animal Model: Forty adult Sprague-Dawley rats we re purchased from MERC. The rats
weredivided in a randomized manner into four groups:Group I (Control group)(n=10):will
receive saline,Group II (Diabeti c rats without stem cell tran splantation) (n=10), Group III

4 
 (Diabetic rats with differentiated BM-MSCstrans plantation)(n=10), and Group IV (Diabetic rats
with differentiated UCB-MSCs transplantation)(n =10).All animals were sacrificed after 6 weeks
from the start of the study.
Induction  of Diabetes mellitus in the rats:The animal model of diabetes was done by
utilizingSTZ (Sigma, St. Louis, Missouri, USA). The rats fasted for 12 hours.STZ was
solubilized in sodium citrate buffer (pH 4.5).Then,injected intra- periotneally w ithin 15 min of
preparation (Akbarzadeh et al., 2007). FBG levels were measuredby a blood glucose meter
(GlucoDr™, All Medicus Co. Lt d, Gyeonggi,Korea).Rats were conf irmed diabetic when FBG >
200 mg/dl for 2 consecutive days (Qinna and Badwan,2015).
Isolation and expansion  of human UCB‐MSCs and BM‐MSCs :UCB sampleswere purchased from
Obstetrics and Gynecology Depa rtment, Mansoura University from full-term deliveries.
Informed written consents were taken from the pa rents. UCB samples were collected in a sterile
blood bag containing anticoagulant . BM aspirates (BMA) were pu rchased from the Clinical
Pathology Department, Mansoura University from 2 donors,diagnosed as hypersplenism.
Informed written consents were taken from the donors. The BMAwas collected from iliac crest in EDTA. The samples were manipulated within 4 – 6 hours from the co llection at MERC. UCB-
MSCs and BM-MSCs were, respectively, isolated in accordance with the methods described by
(Divya et al., 2012), (Gabr et al., 2013). Briefly, UCB and BM samples were diluted in 1×
phosphate buffer saline (PBS) (Lonza,Walkersville, Inc, USA) in a 1:1 ratio, and mono-nuclear
cells (MNCs) were separated by Bicoll (1.077g/ ml, Biochrome,Berlin, Germany) gradient
method. MNCs were washed twice in 1× PBS a nd resuspended in 20 ml of the proliferation
medium consisting of low glucose-Dulbecco’s Modified Eagle Media (DMEM) (Lonza), 1%
penicillin- streptomycin (Lonza), 10 % fetal bov ine serum (FBS) (Sigma), and 1% L-glutamine
(Lonza). The cells were seeded in T75 flasks at a concentration of 5 × 10
6cells/ml. After 2-3 days
of incubation in a 5% CO 2 incubator at 37°C, the non-adherent cells were discarded and
theadherents MSCs were cultured. After 5-7 days of cultivation, the conflu ence of cells reached
80%, the cells were sub-cu ltured using trypsinization.  
Characterization of Isolated MSCs by Flow Cytometry: The cells wereincubated with of
mouse monoclonal antibody agai nst human CD90, CD105, andCD4 5 (R&D systems,USA) or
isotype control for 30 minutes at room temp erature.Then,washed andRe-suspended in 200 μLof

PBS.Th e
Seconda r
™ C6cy t
Inducti o
different i

Figure(1
)
Reverse
extracte d
Corpora t
RNAco n
SCIENT I
(GAPD H
with M m
(Bioline,mix (QI
A
and1 μl o
denatura t
en, stained
ry Antibody
tomete r and
on of differ e
iation was c a
): Differenti a
Transcri p
dfrom undi f
tion,Grand I s
ncentration
IFIC, USA )
H) genes wa s
mlv reverse t r
UK) (Gab r
AGEN Inc,
of each pri m
tion for 10 m
by incubat i
for 30 min u
the BD Acc u
entiation of
arried out i n
ation schem
ptase-pol yme
fferentiated
sland, NY, U
was detect e
).Expressio n
s detected, a
ranscriptase
r et al., 201
Valencia, C
mer. The cyc l
minutes at 9
ion with a
utes. The sta i
uri C6 soft w
BM-MSCs
n multi-stage
e for gener a
erase chai n
and diffe
USA)in acc o
ed by Na n
n of insuli n
s shown in T
according t o
4). The PC R
California, U
ling parame t
95°C, follo w
5 
Phycoeryt h
ined cells w
ware (Hu et a
and UCB- M
protocol, a s
ating IPCs fro
n reaction
rentiated c
ordance wit h
noDrop 20 0
n and Gly c
Table (1). B r
o instructio n
R reaction m
USA), 6 μl o
ters of the P
wed by 35 c
hrin (PE)-c o
ere analyze d
al., 2013).
MSCs to IP C
s shown in F
om BM and 
(RT-PCR )
cells using
h the produc e
00 UV-Vis
ceraldehyde –
riefly, 1μg R
ns of SensiF A
mixture cons i
of sterile di s
CR amplifi c
cycles of (d e
onjugated G
d using a sta n
Cs:At passa g
Figure (1) (G
UCB ‐MSCs 
) analysis: T
TRIzolrea g
er`s specific a
Spectroph o
-3-phosphat e
RNA was re v
AST™ c. D N
isted of 10 μ
stilled wate r
cation were a
enaturation a
Goat Anti- M
ndard BD A
ge 3, induct i
Gabr et al., 2
Total RNA
gent (Invit r
ations. The n
otometer(T h
e dehydrog e
verse transc r
NA Synthes i
μl of PCR- m
r,2μl of c. D
as follows: i
at 95oC for
Mouse
Accuri
ion of
013).
was
rogen
n, The
hermo
enase
ripted
is Kit
master
DNA,
initial
15 s,

6 
 primer annealing at 60oC for 30 s, and extension at 72oC for 20 s) and the final extension at 72°C
for 10 minutes. The PCR products weresepara ted by electrophoresis using3% agarose gel
(Bioline), detected by ethidi um bromide staining(Sigma) (Kim et al., 2012).  
Forward primer Reverse primer PCR
product
size
Insulin 5`GCAGAAGCGTGGCATTGT 3` 5` CATCTCTCTCGGTGCAGGAG 3` 128bp
GAPDH 5` TGCCATGTAGACCCCTTGAA 3` 5` TGGTTGAGCACAGGGTACTT 3` 86 bp
Table (1): Sequence of Insulin, GADPH primers used in RT-PCR
Glucose challenge test: After 20 days of differentiation, theI PCs were incubated in DMEM-low
glucose (5.5mM glucose),andthe culture medium was collected. Then, the cells were incubated
in DMEM-glucose rich (25mM glucose), then th e culture medium was collected. The C-peptide
concentration was detected using C-peptide ELISA kit (immunospeccorporation, Canoga Park, USA) in accordance with the manufacturer`s specifications (Tsai et al., 2012).
Transplantation: On the 4th day after STZ injection, the animal models were anesthetized by
light ether. The abdominal wall was opened and the incision located parallel to the right costal
margin. The liver of diabetic rats was exposed and was injected with differentiated UCB-MSCs,
BM-MSCs using fine needle syringes in a dose of 2×10
6 cells per injection (Chao et al., 2008).
Physiological monitoring: For 6 weeks,FBG levels weredetectedweekly after transplantation
using a blood glucose meter (GlucoDr™,Korea) (Zhou et al.,2015). Sera of rats were collected
weekly for determination of C-peptide using C-pept ide ELISA kit(IMMUNOSPEC) (Tsai et
al.,2014).
Statistical analysis: Data were analyzed using the SPSS(Sta tistics Package for Social Sciences)
software program version 17.0.Stude nt’s t-test is used for comp arison between groups (a P value
of ≤ 0.05 was considered significant).
Results 
Morphology of the cultured MSCs: Under an inverted microscope, undifferentiated BM-MSCs
and UCB-MSCs were adherent spindle shap e.The colony formation could be observed
approximately from day 10.Onthe 20th da y of differentiation, the cells formed

spherica l
MSCs in
Figure ( 2
1B) IPC s
IPCs der i
Flow cyto
of CD90 ,
the BM a
 
 
lclusters,as s
the rate of g
2):Inverted m
s derived f ro
ived from B
ometric analy
, and CD10 5
and UCB-de
shown in fi g
growth or di
microscopic p
om UCB-M S
M-MSCs.  
ysis:As show n
5, but negli g
rived cells w
gure (2). No
fferentiatio n
picture of 1 A
SCs , 2A)u n
n in figure (
gible levels o
were MSCs.
7 apparent di f
n were obser
A)undiffere n
ndifferentiat e
3) UCB-M S
of CD45. Th e
fferences be
ved.
ntiated UC B
ed BM-MS C
SCs and BM –
ese results r e
etween BM- M
B-MSCs on d
Cs on day 1
-MSCsexpr e
eveale d that
MSCs and U
day 10 of c u
0 of culture
essed high l e
the majorit y
UCB-

ulture,
, 2B)
evels
y of

Figure ( 3
Detectio
undiffer e
expressi o
Figure (Lane (
1
Undiffer e
BM-MS C
3):Flow cyto m
n of insuli n
entiated U C
on of GAP D
4):The gel e
1): DNA
entiated UC
Cs, and lane
metry analy s
n gene expr e
CB-MSCs a n
H gene was
electrophor e
marker ( 5
B-MSCs, la n
(5, 9): diffe
sis of UCB a
ession b y RT
nd BM-MS
detecte d, as
esis of the R
50bp,intron
ne (3, 7) di f
rentiated B M
8 and BM-M C
T-PCR: No
Cs, but de t
s a positive c
RT-PCR pro d
biotechn o
fferentiated U
M-MSCs. 
CS for CD1 0
o insulin ge n
tected in t h
control, as s h
ducts of th e
ology,Kyun g
UCB-MSCs
05, CD90 an d
ne expressio n
he differen t
hown in fig u
e Insulin an d
gki-Do,Kore a
, lane (4, 8)
d CD45.
n was detec t
tiated cells.
ure(4).
d GAPDH g
a),lane (2,
: undifferen t
 
ted in
The

genes.
6):
tiated

9 
 In vitro human c-peptide release in res ponse to a glucose challenge :TheIPCs derived from
BM-MSCs and UCB-MSCs released a larger amount of c-peptide at high glucose medium (25
mM) in comparison to low glucose medium (5.5m M). No significant diffe rence in amount of c-
peptide released from BM and UCB-derived cells, as shown in table (2). Tale (2): C-peptide concentration (ng/ml) in low and high glucose culture media.(SD: standard
deviation, P1: significance between BMderived ce lls & and UCBderived cells, P2: significance
between lowglucose medium& andhigh glucose medium).
Mean ± SD IPCs derivd from BM
IPCs derivd from UCB
P1
Low glucose medium 0.35±0.10 0.37±0.12 0.7
High glucose medium 0.84±0.21 0.84±0.18 0.96
P2 <0.001*** <0.001***
Outcomes of transplantation :On the 6th week after transplant ation, FBG levels decreased to
197.2 ± 28.9 mg/dl in-group III, and decreased to 162.5 ± 20.9 mg/dl in-group IV, whereas in
group IIincreased to 476.3± 33.6 mg/dl.FBG levels in diabetic rats transplanted with IPCs
derived from UCB-MSCs is significantly lower th an transplanted with those derived from BM-
MSCs, as shown in Figure(6). IPCs derived from BM-MSCs and UCB-MSCs had the capacity
for in vivorelease measurable amounts of c-peptide in the sera of rats. The levels of human c-
peptide in rats` sera released from transpla nted IPCs derived from BM-MSCs and UCB-MSCs
were non-significantly different,as shown in table (3).
 
Figure (5): changes in FBG levels infour groups of ratsduring the 6 weeks of the experiment. 0100200300400500600
W0 W1 W2 W3 W4 W5 W6FBG levels (mg/dl) Control group
Diabetic  group
Bone marrow 
group
Cord blood 
group

10 
 Table(3): C-peptide concentration (ng/ml) in the sera of rats transp lanted with IPCs derived
from BM-MSCs and UCB-MSCs.
Group III (Transplanted with
BM- derived cells) Group IV (Transplanted with
UCB- derived cells)P
Mean ±SD Mean ±SD
W0 .73 .11 .74 .08 0.95
W1 1.64 .29 1.26 .29 0.008**
W2 2.22 .62 2.04 .51 0.5
W3 2.32 .53 2.29 1.09 0.9
W4 3.55 1.34 3.77 .97 0.68
W5 5.56 1.87 5.12 2.05 0.62
W6 7.88 1.43 6.85 2.15 0.2
Discussion:   
Stem cell differentiation to IPCs has become a potential insulin replacement therapy for T1DM.
MSCs derived from BM (Gabr et al., 213), andUCB (Parekh et al., 2009) has been used in
research on regenerative therapies for DM.In previous studies, owing to the different cell
sources, different differentiati on protocols were applied. The present study compared the
differentiation potential of MSCs derived thos e BM and UCB using the same differentiation
protocol. The present stu dy investigatedtheirs in vitro ability to secrete c-peptide and the in vivo
curative effects in diabetic rats.  
This study revealed that MSCs derived BM and UCB of coul d be isolated based on their
capability to adhere to plastic. The cells at passage 3 were negative for CD45, which indicates
that they were not hematopoietic stem cells and positive for CD90 and CD105which indicates
that they were MSCs; thesefindings coincide with (Dominici et al., 2006). Different
differentiationprotocols have been tried, in the present study, di fferentiation was carried out in
three stages in accordance with (Gabr et al., 2013). High glucose concentration was a
strongstimulusfor pancrea tic islet differentiation (Bonner-Weir et al., 1989). β-mercaptoethanol
was added to induce ex pression of PDX-1 (Wu et al., 2007) . Fibroblast and epidermal growth
factors were used to stimulate pro-insulin biosynthesis (Chatterjee et al., 1986). Activin A
regulates the exogenesis of β-cells in vivo; beta-cellulin helps in regulating the growth of
pancreatic endocrine precursor cells (Li et al., 2004). Nicotinamide is an effective inducer to
maintain islet viability (Kolb H, Burkart V., 1999).

11 
 RT-PCR revealed that differentiated BM and U CB –derived MSCs expre ssed insulin gene. The
IPCs had the ability to secrete c-peptide in vitr o and secreted larger amounts in response to high
glucose concentration in the medium.Transplantation of 2×106IPCs was sufficient to control
hyperglycemia in diabetic rats, this finding coincides with (Tsai et al., 2012 ).The decrease in
FBG levels in diabetic rats after transplant ation with UCB and BM –derived IPCs coincide
with(Tsai et al.,2014) , (Chao et al., 2008). However, at the end of the present experiment, the
FBG levels were higher than control values, this findingcoincides with (Tsai et al., 2014) but
doesn't coincide with ( Chao et al. , 2008) .This may be explained by the difference in the site of
transplantation,or the dose of cells.UCB-derived cells had higher ability to control
hyperglycemia in rats in comparison to those derived from BM, but no significant difference in
theamount of c-peptidereleased from the cells inrats’ sera or in the medium.
Conclusion:
The results show that BM-MSCs andUCB- MSCS can differentiate into IPCs in vitro and can
secrete c-peptide both in vitro and in vivo. These results sugges t that BM-MSCs and UCB-MSCs
are a promising cell source for regenerative therapy in TIDM. Further study is needed to
investigate their curative effects in larger diab etic animal models and to apply clinically in
human beings.
References  
AkbarzadehA, Noruzian D, Jamshidi S, Farhangi A, MehrabiMR, RadBL, Mofidian M, and
AllahverdiA. (2007) : Treatment of streptozotocin induced diabetes in male rats by immune-
isolated transplantation of islet cell s. Indian J Clin Biochem; 22(1):71-6.  
Bonner-Weir S, Deery D, LeahyJL, and Weir GC (1989): Compensatory growth of pancreatic
beta-cells in adult rats afte r short-term glucose infusion. Diabetes; 38(1):49–53.
Chandra V, Swetha G, Muthyala S, Jaiswal AK, Bellare JR, Nair PD and Bhonde RR (2011) : 
Islet-like cell aggregates generated from human adipose tissue derived stem cells ameliorate
experimental diabetes in mice. PLoS One ; 6 (6): e20615.

12 
 Chao KC, Chao KF, Fu YS, and Liu SH (2008): Islet-Like Clusters Derived from
Mesenchymal Stem Cells in Wharton’s Jelly of the Human Umbilical Cord for Transplantation
to Control Type 1 Diabetes . PLoS ONE; 3 (1): e1451.
Chatterjee AK, Sieradzki J,and Schatz H (1986): Epidermal growth factor stimulates (pro-)
insulin biosynthesis and 3H-thym idine incorporation in isolated pancreatic rat islets . Horm
Metab Res; 18 (12): 873–874.
Chen L, Magliano DJ, and Zimmet PZ (2011): The worldwide epidemiology of type 2 diabetes
mellitus-present and future perspectives. Nat Rev Endocrinology; 8 (4): 228-36.
Divya M. S, Roshin G. E, Divya T. S, Rasheed V. A, SanthoshkumarT. R, Elizabeth K. E,
James J, and Pillai R. M (2012): Umbilical cord blood-derived me senchymal stem cells consist
of a unique population of progenitors co-expr essing mesenchymal stem cell and neuronal
markers capable of instantaneous neuronal differentiation. Stem Cell Research& Therapy; 3 (6),
57.
Dominici M, Le Blanc K, Mueller I, Slaper-Co rtenbach I, Marini F, Krause D, Deans R,
Keating A, Prockop Dj, and Horwitz E (2006): Minimal criteria for defining multipotent
mesenchymal stromal cells. . Cytotherapy; 8 (4): 315–317 .
El-Badri N and Ghoneim MA (2013) :Mesenchymal Stem Cell Therapy in Diabetes Mellitus:
Progress and Challenges. J Nucleic Acids ; ID 194858: 1-7.
Gabr MM, Zakaria MM, Refaie AF, Isma il AM, Abou-El-Mahasen MA, Ashamallah SA,
Khater SM, El-Halawani SM, Ibrahim RY, Ui n GS, Kloc M, Calne RY, and Ghoneim MA
(2013) :Insulin-Producing Cells From Adult Huma n Bone Marrow Mesenchymal Stem Cells
Control Streptozotocin-Induced Diabetes in Nude Mice . Cell Transplantation ; 22: 133–145
Gabr MM, Zakaria MM, Refaie AF, Khater SM, Ashamallah SA, Ismail AM, El-Badri N, and
Ghoneim M A et al (2014): Generation of insulin-Producing Ce lls from Human Bone Marrow-
Derived Mesenchymal Stem Cells: Compar ison of Three Differentiation Protocols. BioMed
Research International ; 2014: ID832736.
Hashemian SJ, Kouhnavard M, and Nasli-Esfahani E (2015): Mesenchymal Stem Cells:
Rising Concerns over Their Application in Treatment of Type One Diabetes Mellitus. Journal of
Diabetes Research ; 2015:ID675103.
Hu L, Hu J, Zhao J, Liu J, Ouyang W, Yang C, Gong N, Du L, Khanal A, and Chen L
(2013): Side-by-Side Comparison of the Biological Ch aracteristics of Human Umbilical Cord and

13 
 Adipose Tissue-Derived Mesenchymal Stem Cells. BioMed Research International ; 2013, ID
438243. Khorsandi, L., Khodadadi, A., Nejad-De hbashi, F., &and Saremy, S. (2015): Three-
dimensional differentiation of adipose-derived mesenchymal stem cells into insulin-producing
cells
. Cell and tissue research; 361 (3), 745-753 . 
Kim SJ, Choi YS, Ko ES, Lim SM, Lee CW, and Kim D (2012): Glucose-stimulated insulin
secretion of various mesenhcymal stem cells after insulin-produci ng cell differentiation. Journal
of Bioscience and Bioengeneering ; 113 (6): 771-777.
Kolb H and Burkart V (1999): Nicotinamide in type 1 diabet es (1999): Mechan ism of action
revisited. Diabetes Care; 22 (2): 18–20. Li L, Yi Z, Seno M, and Kojima I (2004): Activin A and betacellulin: effect on regeneration of
pancreatic beta-cells in neonata l streptozotocin-treated rat. Diabetes ; 53 (3): 608–516.
Lilly MA, Davis MF, Fabie JE, Ter hune EB, and Gallicano GI (2016): Current stem cell
based therapies in diabetes. American Journal of Stem Cells ; 5 (3): 87-98.
Mishra PK, Singh SR, Joshua IG, and Tyagi SC (2010) : Stem cells as a therapeutic target for
diabetes. Front Biosci ; 1 (15): 461–477.
Parekh VS, Joglekar MV and Hardikar AA (2009): Differentiation of human umbilical cord
blood-derived mononuclear cells to endocrine pancreatic lineage. Differentiation , 78 (4): 232–
240.
Qinna NA and Badwan AA (2015): Impact of streptozotocin on altering normal glucose
homeostasis during insulin test ing in diabetic rats compared to normoglycemic rats. Drug Design,
Development and Therapy ; 9:2515-25.
Shaw JE, Sicree RA, and Zimmet PZ (2010) : Global estimates of the prevalence of diabetes for
2010 and 2030 . Diabetes research and clinical practice ; 87(1):4–14.  
Trivanovi ć D, Kocić J, Mojsilovi ć S, Krstić A, Ilić V, Djordjevi ć IO, Santibanez JF, Jovci ć G,
Terzić M and Bugarski D (2013) : Mesenchymal stem cells isol ated from peripheral blood and
umbilical cord Wharton's jelly.Srp Arh Celok Lek; 141(3-4):178-86.

14 
 Tsai PJ, Wang HS, Lin CH, Weng ZC, Chen TH, and Shyu JF (2014): Intraportal injection of
insulin-producing cells generate d from human bone marrow mesenc hymal stem cells decreases
blood glucose levels in diabetic rats. Endocr Res ; 39 (1): 26-33.  
Tsai PJ, Wang HS, Shyr YM, Weng ZC, Tai LC, Shyu JF , and Ti Chen TH
(2012): Transplantation of insulin-pr oducing cells from umbilical cord mesenchymal stem cells
for the treatment of streptoz otocin-induced diabetic rats .Journal of Biomedical Science ; 19:47 .
Wu XH, Liu CP, Xu KF, Mao XD, Zhu J, Jiang JJ, Cui D, Zhang M, Xu Y, and Liu C (2007):
Reversal of hyperglycemia in diabetic rats by portal vein transplanta tion of islet-like cells
generated from bone marrow mesenchymal stem cells .World J Gastroenterol . ; 13(24):3342–
3349. Yang XF, Chen T, Ren LW, Yang L, Qi H, and Li FR (2017): Immunogenicity of insulin-
producing cells derived from human umb ilical cord mesenchymal stem cells. Experimental and
Therapeutic Medicine ; 13 (4): 1456-1464.
Yi B, Huang G, Zhou Z (2016): Different role of zinc transpor ter 8 between type 1 diabetes
mellitus and type 2 diabetes mellitus. J Diabetes Investig .; 7 (4): 459-65.
Zhou Y, Hu Q, Chen F, Zhang J, Guo J, Wang H, Gu J, Ma L, and Ho G (2015): Human
umbilical cord matrix-derived st em cells exert trophic effects on β-cell survival in diabetic rats
and isolated islets. Disease Models & Mechanisms ;8(12): 1625-1633.
Zhu B, Wu X, Wu B, Pei D, Zhang L, and Wei L (2017): The relationship between diabetes and
colorectal cancer prognosis: A meta -analysis based on the cohort studies . PLoS one; 12(4):
e0176068.