Received 15 Sep 2016 Accepted 24 Feb 2017 Published 4 Apr 2017 [614368]

ARTICLE
Received 15 Sep 2016 |Accepted 24 Feb 2017 |Published 4 Apr 2017
Low-dose penicillin in early life induces long-term
changes in murine gut microbiota, brain cytokines
and behavior
Sophie Leclercq1,2, Firoz M. Mian1, Andrew M. Stanisz1, Laure B. Bindels3, Emmanuel Cambier4,
Hila Ben-Amram5, Omry Koren5, Paul Forsythe1,6& John Bienenstock1,2
There is increasing concern about potential long-term effects of antibiotics on children’s
health. Epidemiological studies have revealed that early-life antibiotic exposure can increasethe risk of developing immune and metabolic diseases, and rodent studies have shown thatadministration of high doses of antibiotics has long-term effects on brain neurochemistry andbehaviour. Here we investigate whether low-dose penicillin in late pregnancy and earlypostnatal life induces long-term effects in the offspring of mice. We find that penicillin haslasting effects in both sexes on gut microbiota, increases cytokine expression in frontalcortex, modifies blood–brain barrier integrity and alters behaviour. The antibiotic-treated miceexhibit impaired anxiety-like and social behaviours, and display aggression. Concurrentsupplementation with Lactobacillus rhamnosus JB-1 prevents some of these alterations. These
results warrant further studies on the potential role of early-life antibiotic use in thedevelopment of neuropsychiatric disorders, and the possible attenuation of these by
beneficial bacteria.DOI: 10.1038/ncomms15062 OPEN
1McMaster Brain-Body Institute at St Joseph’s Healthcare Hamilton, 50 Charlton Avenue East T3304, Hamilton, Ontario, Canada L8N 4A6.2Department of
Pathology and Molecular Medicine, McMaster University, 50 Charlton Avenue East, Hamilton, Ontario, Canada L8N 4A6.3Metabolism and Nutrition
Research Group, Louvain Drug Research Institute, Universite ´Catholique de Louvain, Avenue E. Mounier 73, Brussels 1200, Belgium.4Faculty of Medicine,
Universite ´Catholique de Louvain, Brussels 1200, Belgium.5Faculty of Medicine, Bar-Ilan University, Henrietta Szold 8, Safed 1311502, Israel.6Firestone
Institute for Respiratory Health and Department of Medicine, McMaster University, 50 Charlton Avenue East, Hamilton, Ontario, Canada L8N 4A6.
Correspondence and requests for materials should be addressed to S.L. (email: [anonimizat]) or to J.B. (email: [anonimizat]).
NATURE COMMUNICATIONS | 8:15062 | DOI: 10.1038/ncomms15062 | www.nature.com/naturecommunications 1

Oral antibiotics (AB), particularly the penicillins, are the
most frequently dispensed drugs in children worldwide1.
There is increasing concern that AB exposure early in life
may have long-term detrimental consequences for health2.
Epidemiological studies report an association between the use
of AB during the perinatal period and an increased risk of
developing childhood diseases that may persist into adulthood.
For instance, maternal use of AB during pregnancy or
breastfeeding is a risk factor for development of wheezing and
allergy in the offspring3,4, and AB exposure during the first years
of life is associated, dose-dependently, with allergic diseases5,6,
inflammatory bowel diseases7, obesity8,9, as well as poorer
neurocognitive outcomes later in life10. Recent experimental
studies11,12have found that alteration of the gut microbiota
induced by early life AB exposure may drive lasting immune and
metabolic consequences in mice. More particularly, Russell et al.13
showed in mice that the pre-weaning period is critical for
antibiotic-driven shift in microbiota to alter the immune
response and increase susceptibility to allergy11. In addition,
Cox et al.12showed that mice treated continuously with low-dose
penicillin from 1 week before birth until weaning, exhibited higher
body weight and fat mass in adulthood, although the microbial
structure returned to normal after 4 weeks of AB cessation. These
results strongly suggest that early-life dysbiosis can have long-term
detrimental health effects.
There is now mounting evidence, in humans and rodents, for
the role of specific microbial compositions in modulating brain
function including behaviour14–17. Complete absence of intestinal
bacteria (in germ-free mice) results in modification of blood–
brain barrier (BBB) permeability18, impaired immune response
of the microglia19, increased myelination20, hyperactivity of
the hypothalamus–pituitary–adrenal axis21, changes in brain
neurochemistry22and decreased anxiety and social
behaviours22,23. Germ-free mice provide useful models to
establish possible causality in rodent gut microbiota–brain
interactions, but provide only suggestive clinical relevance.
Several studies have shown that high doses of a cocktail of AB,including anti-fungal agents, in adult or adolescent mice induced
changes in gut microbiota associated with behaviouralalterations24–27, but these combinations of AB are never
routinely used in clinical practice. By contrast, probiotics
administration in mice restores intestinal barrier function28,
normal stress response21and brain chemistry29and, in humans,
changes brain activity30. In addition, Lactobacillus rhamnosus JB-
1 have demonstrated psychoactive and neuroactive properties31,
by reducing anxiety and depression-like behaviours in healthy
mice via the vagus nerve32.
Here we investigate the long-term consequences of a low dose
of penicillin given to mice during the perinatal period (from 1
week before birth to weaning) on gut microbiota, intestinal
barrier function, BBB integrity, cytokines expression and
behaviour. Because mood disorders occur more frequently in
women than men33, we looked for differential effects in both male
and female mice. We also tested whether concurrent
supplementation with Lactobacillus rhamnosus JB-1 (JB-1) may
counteract the biological and behavioural changes induced by
early life AB. We find that AB-treated mice have lasting changes
in gut microbiota, modified BBB integrity in the hippocampus,
increased levels of cytokines in the frontal cortex and behavioural
alterations including decreased anxiety-like behaviour and
increased aggression in males as well as reduced social
behaviour in males and females. We show partial preventive
effects of L. rhamnosus JB-1 supplementation. These results
support the necessity to further investigate the potential negative
long-term effects of early-life AB exposure, particularly with
regard to neuropsychiatric disorders.
Results
Design of experiments . BALB/c dams received low doses of
penicillin V (AB group; 18:00–9:00, 31 mg kg/C01per day) 1 week
before pups’ birth and up until weaning (postnatal day 21
(PND21)), so that the pups were initially colonized with an
altered maternal microbiota and then received AB while nursing.
Another group of dams (AB/JB1) received penicillin (18:00–9:00,
31 mg kg/C01per day) and L. rhamnosus JB-1 (9:00–18:00,
109c.f.u. per day). A control group (CT) received water and food
ad libitum (Fig. 1).
PND0 = delivery
Beginning of Tx
(pregnant dams) E12-14 PND21 = weaning
End of Tx
(dams)PND42
!In utero + postnatal
exposure of pups to Tx
Sex
TxFemale Male Total
CT 17 11 28
AB 13 12 25
AB/JB1 13 6 19
Total 43 29 72Number of pups** * **
CT
AB
AB/JB1Euthanize
Euthanize
* Gut microbiota analysis (dams)
* Gut microbiota analysis (offspring)Behaviour / Microdefeat
Behavioural tests /
open field
social behavior
preference for social novelty
elevated plus maze
Figure 1 | Study design. One week before delivery (embryonic days 12–14), pregnant dams received either penicillin V (AB, n¼4) or penicillin V and
Lactobacillus rhamnosus JB-1 (AB/JB1, n¼3) in drinking water. The control (CT, n¼5) group received only regular water. The treatment (T x) was continued up
until weaning (postnatal day 21, PND21). After weaning, the pups ( n¼72) were separated from the dams and received regular water. At 6 weeks old
(postnatal day 42, PND42), the offspring was subjected to a battery of behavioural tests. After the last test, females were euthanized while males wer e
subjected to the microdefeat paradigm. Forty-eight hours following microdefeat, males were euthanized and blood, intestinal and brain tissues wer e collected.ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15062
2 NATURE COMMUNICATIONS | 8:15062 | DOI: 10.1038/ncomms15062 | www.nature.com/naturecommunications

AB did not affect locomotor activity . When the offspring (both
sexes) were 6 weeks (postnatal day 42 (PND42)), they were
first tested for locomotor activity. No main effect of treatment
(two-way ANOVA: F2,66¼0.062, P¼0.940), sex ( F1,66¼0.542,
P¼0.464) or treatment /C2sex interaction ( F2,66¼0.697,
P¼0.502) were observed on the total distance travelled in the
open field, reflecting that general locomotor activity was similar
in all mice (Fig. 2a)
Regarding time spent in the central area of the open field, a
main effect of sex was found ( F1,65¼4.98, P¼0.029) while no
effect of treatment ( F2,65¼1.84, P¼0.17) or treatment /C2sex
interaction ( F2,65¼1.69, P¼0.19) were observed. The sex effect
was due to the difference in time spent in the centre between
males and females within the control group ( P¼0.005 after
Bonferroni correction; Supplementary Fig. 1).
AB decreased anxiety-like behaviour in males . Results of the
elevated plus maze (EPM) showed no main effect of sex on the
number of open arm entries (two-way ANOVA: F1,65¼0.014,
P¼0.906), however, a main effect of treatment ( F2,65¼6.109,
P¼0.004) and treatment /C2sex interaction ( F2,65¼4.15,
P¼0.02) were observed. Thus treatment affected anxiety-like
behaviour and more importantly, both sexes were differentlyaffected (Fig. 2b). In males, the number of entries in the
open arms of AB-treated animals was higher than in
CT ( P¼0.003, post hoc test with Bonferroni correction) reflecting
a decreased anxiety-like behaviour. In females, AB treatment didnot alter anxiety-like behaviour (CT versus AB, P¼0.325), but
mice treated with AB/JB1 exhibited a lower anxiety level
compared to CT ( Po0.001) and AB groups ( P¼0.013). There
was no difference in anxiety-like behaviour between males and
females within the CT group ( P¼0.994). However, anxiety level
was lower in males than in females within the AB group
(P¼0.021) while there was a trend toward a lower anxiety-like
behaviour in females compared to males in AB/JB1 group
(P¼0.08). The same results were obtained for the time spent and
the distance travelled in the open arms (Supplementary Fig. 2a,b).
Anxiety-like behaviour is also assessed as a ratio of open to
total arms entries34. No main effect of sex ( F1,65¼0.68, P¼0.41)
but a main effect of treatment ( F2,65¼7.11, P¼0.002) and
treatment /C2sex interaction ( F2,65¼3.75, P¼0.03) were observed
(Supplementary Fig. 2c). Results of time and distance in the
closed arms are presented in Supplementary Fig. 2d,e. The total
distance travelled in the EPM, total number of entries as well as
number of entries in the closed arms were similar in all groups
reflecting no alteration of locomotor activity (Supplementary
Fig. 2f–h).
Males Females01,0002,0003,0004,000Total
distance (cm)CT
AB
AB/JB1
Males Females0510152025Number of entries
in open armsCT
AB
AB/JB1
CT
AB
AB/JB1CT
AB
AB/JB1***
* ***P = 0.08
0100200300400Time (s)**P = 0.10**
Mouse
chamberObject
chamber
CT AB AB/JB10.00.51.01.52.0Wound scoreScore*0100200300400Time (s)** **
Stranger
2Stranger
1
CT AB AB/JB101020304050Percentage
of resilient mice%
1/115/12
1/5Open field Elevated plus maze
Social behaviour Preference for social novelty
Social avoidance following microdefeatab
cd
ef g
CT AB AB/JB1050100150200Time (s)Time spent
with the aggressor
Figure 2 | Effect of early life AB and AB/JB1 treatments on behaviour. (a,b) Male and female mice were tested for locomotor activity in the open field
and for anxiety-like behaviour by using the elevated plus maze ( a;n¼72 (males, n¼11 CT, 12 AB, 6 AB/JB1: females, n¼17 CT, 13 AB, 13 AB/JB1),
(b);n¼71 (males, n¼10 CT, 12 AB, 6 AB/JB1: females, n¼17 CT, 13 AB, 13 AB/JB1)) (two-way ANOVA). ( c,d). Social behaviour and preference for social
novelty were tested in the three-chambered apparatus ( n¼69; males, n¼11 CT, 12 AB, 6 AB/JB1: females, n¼16 CT, 12 AB, 12 AB/JB1) (two-way ANOVA).
(e–g) Males ( n¼11 CT, 12 AB, 5 AB/JB1) were subjected to microdefeat and tested 24 h later for social avoidance. Results are means ±s.e.m. (except for
graph F where results are means ±s.d.). * Po0.05, ** Po0.01, *** Po0.001. AB, antibiotic; AB/JB1, antibiotic and L. rhamnosus JB-1; CT, control.NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15062 ARTICLE
NATURE COMMUNICATIONS | 8:15062 | DOI: 10.1038/ncomms15062 | www.nature.com/naturecommunications 3

These results suggest that early life AB treatment decreased
anxiety-like behaviour in males as well as in females that also
received JB-1.
Lactobacillus prevented AB-induced decrease in sociability .
Mice were tested in the three-chamber apparatus for social
interactions. Sociability is defined as the experimental mouse
spending more time in the chamber containing the novel mouse
than in that containing the novel object. Analysis revealed a main
effect of treatment (two-way ANOVA: F2,64¼5.04, P¼0.009) on
the time spent in the novel mouse chamber but no main effect of
sex ( F1,64¼0.84, P¼0.363) and no significant treatment /C2sex
interaction ( F2,64¼1.203, P¼0.307). Male and female mice were
not differently affected by the treatment. Post hoc tests showed
that AB-treated mice spent less time in the novel mouse chamber
compared to CT ( P¼0.002) and AB/JB1 mice ( P¼0.10; Fig. 2c).
Also, there was a main effect of treatment ( F2,64¼3.39,
P¼0.04) on the time spent in the chamber containing the novel
object but no main effect of sex ( F1,64¼0.005, P¼0.994) or
treatment /C2sex interaction ( F2,64¼0.67, P¼0.517). AB-treated
mice spent more time in the object chamber compared to CT
(P¼0.019) and AB/JB1 ( P¼0.049) groups (Fig. 2c). These results
show that early life AB treatment reduced social behaviour.
However, concurrent ingestion of JB-1 prevented this reduction
of sociability. Data on time spent in each chamber (centre, mouse,
object) are presented for both sexes separately in Supplementary
Fig. 3.
Lactobacillus prevented AB-induced decrease in social novelty .
Mice were then tested for preference for social novelty by
assessing time spent with a novel stranger or the initial stranger,
respectively strangers 2 and 1. Two-way ANOVA revealed a main
effect of treatment ( F2,64¼3.92, P¼0.025/ F2,64¼3.82, P¼0.027)
but not sex ( F1,64¼0.13, P¼0.72/ F1,64¼0.083, P¼0.78) or
treatment /C2sex interaction ( F2,64¼2.32, P¼0.107/ F2,64¼1.60,
P¼0.21) on the time spent in the chambers containing either
the stranger 2 or stranger 1, respectively. Post hoc tests showed
that AB-treated mice spent less time with stranger 2 compared to
CT ( P¼0.027) and AB/JB1 groups ( P¼0.044), and more time
with stranger 1 compared with CT ( P¼0.049) and AB/JB1
(P¼0.019; Fig. 2d). This shows that AB treatment decreased
preference for social novelty, an effect that was prevented
by concurrent supplementation with JB-1. When analysed
separately for males and females, the preventive effect of
JB-1 supplementation was more pronounced in females
(Supplementary Fig. 4).
AB increased aggression and reduced social avoidance . BALB/c
males were subjected to the microdefeat paradigm consisting of
three sessions of 3 min during which they were physically stressed
by an unfamiliar male CD-1 aggressor. All CT animals typically
exhibited a submissive upright posture in response to CD-1
attacks (Supplementary Movie 1). Surprisingly, some AB-treated
males fought back and exhibited upright offensive posture as well
as rapid tail rattles characteristic of aggressive behaviour35
(Supplementary Movie 2). Wound scores, measured at the endof the last defeat session, were significantly lower in the AB group
compared to CT ( P¼0.048, Kruskal–Wallis test; Fig. 2e).
Twenty-four hours after the last defeat session, BALB/c males
were tested for social avoidance with regard to a new, unfamiliar,
CD-1 aggressor. Forty two percent (5/12) of AB-treated mice
spent more time interacting with the aggressor and were therefore
considered resilient to stress, compared to 9% (1/11) in CT and
20% (1/5) in AB/JB1 group (Fig. 2f,g). Mice treated with AB earlyin life had 3.5 times more risk to become resilient to stress
compared to CT mice (relative risk ¼3.5, CI 95% (0.56–22.08)).
AB induced major gut microbial changes in dams and off-
spring . Analysis of the gut microbiota was performed in dams
before (T0) and after 1 and 4 weeks of treatment (T1, T2) and in
the offspring at 3-week-old (PND21) and at 6-week-old (PND42).
The pups were exposed to the treatment in utero (1 week before
birth) and while nursing until weaning. At PND21, the treatment
was stopped (Fig. 1).
To assess the effect of AB treatment on dams, we first analysed
the beta diversity (between-sample diversity; Supplementary
Fig. 5a (unweighted UniFrac) and Supplementary Fig. 6
(weighted UniFrac)). This revealed a strong AB effect where the
AB and AB/JB1 groups were significantly different from CT
(P¼0.001). When looking at the alpha diversity (within-sample
diversity; Supplementary Fig. 7), there was no difference between
groups at T0; at T1 and T2, the AB and AB/JB1 groups had lower
diversity than CT but the results were not statistically different
(t-tests) due to the small number of dams. The relative
abundances of the two dominant phyla, Bacteroidetes and
Firmicutes, were largely decreased after 1 week of AB treatment
(Supplementary Fig. 5b). However, even if the treatment was
continued for 3 more weeks, these two phyla returned to control
levels at T2. The largest change was observed for the phylum
Proteobacteria, which represented o0.5% of total operational
taxonomic unit (OTU) counts in CT dams and around 80% in AB
and AB/JB1-treated dams after 1 week of treatment. At T2, the
level of Proteobacteria decreased significantly but remained
higher than in the CT group. AB treatment also induced a
decrease in Cyanobacteria and Actinobacteria (SupplementaryFigs 5b and 8).
The microbiota of offspring of the AB and AB/JB1 groups was
significantly less diverse than the control group (Supplementary
Fig. 9 (alpha-diversity)) and also cluster separately from the
control group ( P¼0.001; Fig. 3a (beta-diversity unweighted
UniFrac) and Supplementary Fig. 10 (weighted UniFrac)).
Importantly, the dysbiosis remained until PND42, 3 weeks after
ceasing treatment (Fig. 3). Analysis of relative abundances
revealed that all bacterial phyla were changed following AB
treatment (Fig. 3b–d). The relative abundances of two dominant
phyla, Bacteroidetes and Firmicutes, were respectively decreased
and increased in AB-treated mice. The most drastic change
concerned the phylum Proteobacteria that was respectively
65- and 37 times more abundant in AB- and AB/JB1-treated
mice compared to CT at PND21. Cessation of AB treatment after
weaning allowed a significant reduction of Proteobacteria in AB
and AB/JB1 mice at PND42 but its level was still largely higher
than in CT. The phylum Deferribacteres was almost totally absent
in all mice treated with AB and AB/JB1 while present in all CT
mice, at both study time points. While the phylum Cyanobacteria
remained stable over time in CT mice, the relative abundance of
this phylum significantly increased from PND21 to PND42 in AB
and AB/JB1 mice.
The significant decrease in Bacteroidetes following AB
treatment was mainly due to a drastic reduction in the bacterial
families S24-7, Prevotellaceae, Rikenellaceae and Odoribacter-
aceae. It is important to note that supplementation with JB-1
prevented the drop of S24-7 (Supplementary Figs 11 and 12).
The increase in Firmicutes following AB treatment was due to a
large increase in Lachnospiraceae, Clostridiaceae and Erysipelo-
trichaceae while the relative abundance of Lactobacillaceae was
very low in AB and AB/JB1 groups (Supplementary Table 1).
Supplementation with JB-1 prevented the changes in Lachnospir-
aceae and in Erysipelotrichaceae. A significant increase from
PND21 to PND42 was observed for all treatment groups inARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15062
4 NATURE COMMUNICATIONS | 8:15062 | DOI: 10.1038/ncomms15062 | www.nature.com/naturecommunications

Ruminococcaceae and Dehalobacteriaceae (Supplementary
Figs 11 and 13). The large increase in Proteobacteria was induced
by the family Enterobacteriaceae, which represented 45% of all
bacteria in AB-treated mice, 25% in AB/JB1 mice and o1% in CT
mice (Supplementary Figs 11 and 14). Overall, male and female
mice exhibited similar gut microbiota composition
(Supplementary Fig. 15) except for the family Anaeroplasmata-
ceae (Supplementary Fig. 16). To our knowledge, the role of
Anaeroplasmataceae in host physiology remains unknown.AB did not induce change in gut barrier or inflammation . Male
and female mice treated with AB and AB/JB1 exhibited similar
messenger RNA expression of cytokines (TNF a, IL-1b, IL-6 and
IL-10) and chemokine (Cxcl15) and of tight junctions
(TJs; occludin, zonula occludens 1 (ZO-1)) in colon compared to
the CT groups (Fig. 4a–d). Similar results were obtained for the
ileum (Supplementary Tables 2 and 3). The faecal albumin level
was similar in all treatment groups in females, and lower in
AB-treated males compared to CT (Fig. 4e,f). Altogether, these
0.00.51.01.54080Phylum RA/RA
in CT-PND21PND21
**
****#
** ***#
01241016PND42
*****
*#
**
*****#
$$$$$$
$
$
$$$$$$Offspring — PhylaCT AB AB/JB1
CT
AB
AB/JB1a
b
cdOffspring — β-diversity
100%
90%
80%
70%60%50%
40%30%
20%10%
0%Actinobacteria
Cyanobacteria
Deferribacteres
Tenericutes
Proteobacteria
Firmicutes
Bacteroidetes
CT-PND21 CT-PND42 AB-PND21 AB-PND42
AB/JB1-PND21 AB/JB1-PND42PC2
(9%)
PC3 (6%) PC1
(36%) PC2
(13%)
PC3 (7%) PC1
(31%) PND21 PND42
Bacteroidetes
Firmicutes
Proteobacteria
Tenericutes
Deferribacteres
Cyanobacteria
ActinobacteriaBacteroidetes
Firmicutes
Proteobacteria
Tenericutes
Deferribacteres
Cyanobacteria
Actinobacteria
Figure 3 | Gut microbiota composition in offspring at 3 and 6 weeks old. (a)b-Diversity calculated with unweighted UniFrac matrix showing significant
differences ( P¼0.01) at both time points (PND21, 3 weeks old; PND42, 6 weeks old). ( b) Relative abundance of bacteria phyla, expressed in percentage.
(c,d) To better visualize the change induced by AB treatment in low-abundance phyla, the relative abundance of each phylum has been divided by the mean
of relative abundance obtained in the CT group at PND21. The red line indicates the mean relative abundance of the phylum in the CT group at PND21,
which corresponds to the value 1. Results are means ±s.e.m., n¼68 (26 CT, 24 AB, 18 AB/JB1) (mixed ANOVA). * Po0.05 compared to CT group after
Bonferroni adjustment for multiple comparisons (within the same study time point).#Po0.05 compared to AB group after Bonferroni adjustment for
multiple comparisons (within the same study time point).$Po0.05 compared to PND21, within the same experimental treatment group. AB, antibiotic;
AB/JB1, antibiotic and L. rhamnosus JB-1; CT, control; PND, postnatal day; RA, relative abundance.NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15062 ARTICLE
NATURE COMMUNICATIONS | 8:15062 | DOI: 10.1038/ncomms15062 | www.nature.com/naturecommunications 5

data suggest that early life AB treatment did not disrupt the gut
barrier and did not induce intestinal inflammation.
AB induced changes in brain Avpr1b and cytokine expression .
We investigated whether changes in behaviour observed
following early life AB treatment could be related to changes in
gene expression in hippocampus and frontal cortex, two
important brain areas involved in the regulation of behaviour. We
found that the expression of arginine vasopressin receptor 1B
(Avpr1b), known to be involved in aggressive behaviour35, was
substantially increased in the frontal cortex of both males and
females treated with AB but not in the hippocampus (Fig. 5 and
Supplementary Fig. 17).
BBB integrity was assessed by measurement of mRNA and
protein expression of TJ occludin, and claudin-5 (Cldn5), key
markers of the BBB integrity modulated by gut microbiota18.I nt h e
hippocampus, AB-treated males and females exhibited a significant
increase in the mRNA expression of all TJ compared to CT mice
(Fig. 6a,b). Western blot analysis confirmed the increase in TJ
protein expression (Fig. 6e–g). AB/JB1 mice expressed
hippocampal mRNA and TJ protein levels which were
intermediate between CT and AB mice (Fig. 6a,b,e–g). In the
frontal cortex, the mRNA expression of occludin was slightly
increased in AB and AB/JB1 males while levels of cldn5 were not
different from controls. In females, the levels of all TJ in the frontal
cortex were similar in all groups (Fig. 6c,d). We conclude that early
life AB treatment modified the BBB integrity in the hippocampus.
No changes in the expression of cytokines TNF a, IL-1b, IL-6,
IL-10 and chemokine Cxcl15 (analogue of IL-8) were observed in
the hippocampus of AB and AB/JB1 male or female mice
(Fig. 6h,i). An increase in the expression of IL-6, IL-10 and
Cxcl15 was seen in the frontal cortex of both sexes treated with
AB (Fig. 6j,k). AB/JB1 males also expressed higher levels of IL-6,
IL-10 and Cxcl15 in the frontal cortex compared to CT, while thelevel of these markers in AB/JB1 females were intermediate
between AB and CT mice (Fig. 6j,k). Interestingly, the expression
of these cytokines was positively correlated with the expression of
Avpr1b in both sexes (Supplementary Fig. 18), in line with the
recently discovered role for vasopressin and its receptor as
regulators of neuroinflammation36.
These results show evidence of cytokine changes in the frontal
cortex of both sexes induced by AB that were partially prevented
in the AB/JB1 female group. They also suggest that the
reinforcement of hippocampal BBB integrity may have prevented
the increase in inflammatory markers, as suggested by negative
correlations between TJ and IL-6, IL-10 and Cxcl15
(Supplementary Table 4). By contrast, in the frontal cortex, TJ
were positively correlated with increased cytokines in both males
and females (Supplementary Table 5).
Brain cytokines were not related to systemic inflammation .
Systemic inflammation can lead to increased levels of cytokines in
the brain and is associated with mood disorders37. Peripheral
cytokines can reach the brain through a leaky BBB or through
humoral, neural and cellular pathways38. We therefore assessed
the levels of inflammatory cytokines in the systemic circulation to
check if increases in brain cytokines could reflect a peripheral
immune response. We found no increase in the serum levels of
TNFa, IL-1b, IL-10 or in functional murine IL-8 homologues
Cxcl1/KC, Cxcl2/MIP-2a and Cxcl5-6/LIX in AB-treated mice,
suggesting that the increase in cytokines levels observed in frontal
cortex of both sexes was not induced by a peripheral immune
response (Supplementary Fig. 19).
Discussion
Beta-lactam AB are the most frequently prescribed drugs in
infants and children1but their long-term effects on health have
received scant attention until recently. Several clinical reportsTNFα
IL-1βIL-6IL-10Cxcl150.00.51.01.5InflammationmRNA levels
(relative expression)
TNFα
IL-1βIL-6IL-10Cxcl150.00.51.01.52.0InflammationmRNA levels
(relative expression)Occludin ZO-10.00.51.01.5Tight junctions
Occludin ZO-10.00.51.01.5Tight junctionsCT AB AB/JB1020406080100ng mg–1 faecesFecal albumin
**P = 0.054
CT AB AB/JB1020406080100ng mg–1 faecesFaecal albuminMales
Femalesac e
b d fCT AB AB/JB1
Figure 4 | Assessment of inflammation and intestinal permeability in colon. (a,b) Intestinal inflammation was evaluated by the mRNA expression of
cytokines and chemokine. ( c–f) Evaluation of intestinal barrier integrity was performed by measuring mRNA expression of tight junctions and fecal albumin
concentration. Results are means ±s.e.m. (s.d. for e,f),n¼28 males (11 CT, 12 AB, 5 AB/JB1) and 43 females (17 CT, 13 AB, 13 AB/JB1) (one-way ANOVA).
Red dot in graphs ( e,f) indicates that the level of faecal albumin was below the detection limit. ** Po0.01. AB, antibiotic; AB/JB1, antibiotic and
L. rhamnosus JB-1; CT, control.ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15062
6 NATURE COMMUNICATIONS | 8:15062 | DOI: 10.1038/ncomms15062 | www.nature.com/naturecommunications

have shown an association between early life AB use and an
increased risk of developing allergies3,4, inflammatory bowel
diseases7, obesity8,9as well as poorer neurocognitive outcomes
later in life10. Altered gut microbial composition early in life may
play a causal role in the lasting immune and metabolic changes
associated with these diseases12,13. However, the impact ofintestinal dysbiosis induced by early-life AB exposure on brain
function and behaviour remains unknown. Increasing evidence
indicates that intestinal bacteria might communicate with the
brain to induce changes in behaviour and neurochemistry14–16.
While germ-free models or administration of high doses of AB in
animals have revealed behavioural and cognitive alterationsCT AB AB/JB102468mRNA level
(relative expression)Avpr1b
**
CT AB AB/JB102462040mRNA level
(relative expression)Avpr1b
**P = 0.10Males Females ab
Figure 5 | Brain expression of arginine vasopressin receptor 1B. Avpr1b (arginine vasopressin receptor 1b) is known to be involved in the regulation of
aggressive behaviour and brain cytokines changes. mRNA expression measured in the frontal cortex of ( a) males ( n¼27, 11 CT, 12 AB, 4 AB/JB1) and
(b) females ( n¼42, 17 CT, 13 AB, 12 AB/JB1; one-way ANOVA). Results are means ±s.d. ** Po0.01. AB, antibiotic; AB/JB1, antibiotic and L. rhamnosus JB-1;
CT, control.
0.00.51.01.52.0MalesmRNA levels CT AB AB/JB1 CT AB AB/JB10.00.51.01.52.0Cldn5 (protein)Densitometric ratio
claudin-5/ β-actin
Densitometric ratio
occludin/ β-actin***P = 0.06
0.00.51.01.5Occludin (protein)
*P = 0.09Hippocampus Frontal cortex
CT AB AB/JB1
Hippocampus Frontal cortexa bd c
ef
hi j kCT
AB
AB/JB1Tight junctions
CytokinesOccludin Cldn50.20.61.01.41.82.2mRNA levels Males
***** $
Occludin Cldn50.00.51.01.5mRNA levels Females
*****#
Occludin Cldn50.00.51.01.52.0mRNA levels Males
**
Occludin Cldn50.00.51.01.52.0mRNA levels Females
TNFα
IL-1β
IL-6IL-10Cxcl15TNFα
IL-1β
IL-6IL-10Cxcl15TNFα
IL-1β
IL-6IL-10Cxcl15TNFα
IL-1β
IL-6IL-10Cxcl1501234mRNA levels Females
012345MalesmRNA levels *#*******
012515mRNA levels Females
**
*****
$Claudin-5
Occludin
β-Acting
Figure 6 | Brain tight junctions and cytokine expression. (a–d) mRNA expression of tight junctions measured in the hippocampus and the frontal cortex
of male and female mice. ( e–g) Representative western blot of tight junctions proteins claudin-5 and occludin performed in hippocampus of male mice
and quantification by densitometry normalized to the loading control b-actin (in total: n¼5 CT, 8 AB and 4 AB/JB1 mice). Full blots are shown in
Supplementary Fig. 22. ( h–k) mRNA expression of cytokines and chemokine in hippocampus and frontal cortex of male and female mice. Results are
means±s.e.m. (Hippocampus n¼24 males (9 CT, 11 AB, 4 AB/JB1) and 39 females (15 CT, 11 AB, 13 AB/JB1); frontal cortex n¼28 males (11 CT, 12 AB, 5
AB/JB1) and 42 females (17 CT, 13 AB, 12 AB/JB1)) (one-way ANOVA) * Po0.05, ** Po0.01, *** Po0.001 versus CT.#Po0.05 versus AB and$Po0.10
versus AB. AB, antibiotic; AB/JB1, antibiotic and L. rhamnosus JB-1; CT, control.NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15062 ARTICLE
NATURE COMMUNICATIONS | 8:15062 | DOI: 10.1038/ncomms15062 | www.nature.com/naturecommunications 7

associated with dysbiosis22–26, they have unclear clinical
relevance.
We tested first whether a low dose of penicillin (in our opinion,
more clinically relevant than the higher AB doses used in someprevious studies) early in life had long-term effects on gut
microbiota composition, intestinal and BBB permeability, intest-
inal and brain cytokines expression and behaviour. Secondly,
we investigated whether concurrent supplementation with
L. rhamnosus JB-1, a psychoactive and neuroactive beneficial
bacterium31,32, can counteract the biological and behavioural
effects of AB treatment. Since alteration of pre-weaning
microbiota induced by continuous AB exposure leads to lasting
immune and metabolic changes11,12, penicillin V alone or
concurrently with JB-1 were given continuously to pregnant
dams 1 week before delivery and up until weaning. Ingested
penicillin V is found in the fetal circulation and in breast milk39.
The pups were therefore exposed to AB prenatally and
postnatally, while nursing. We followed the design of a
previous study that showed that sustained perinatal exposure to
low-dose penicillin induced long-term changes in body weight
and fat mass12. We found that early life AB treatment induced
long-term changes in gut microbiota composition, BBB integrity
and brain cytokines as well as behaviour. We also found that
concurrent supplementation with L. rhamnosus JB-1 can
attenuate certain deleterious effects of AB; however, this
conclusion should be validated in further research, as the
number of litters/dams, and the number of males in the AB/
JB1 group, were relatively small. In addition, future studies should
treat separate cohorts of mice with penicillin either in utero or
from birth to weaning, to establish the importance of timing of
AB exposure in the development of a specific adult phenotype.
We also acknowledge that sustained exposure, through pregnancy
and weaning, may not completely mimic the common use of AB
in children. Future studies should also investigate the minimum
number and duration of repeated AB exposures in early life that
lead to long-term changes in host physiology.
We observed changes in the gut microbiota of AB-treated
dams, especially at delivery of pups. Although we did not assess
the dams’ vaginal microbiota, we think that the pups were
probably colonized at birth by an altered maternal microbiota
because oral antibiotics have been shown to lower vaginal levels
ofLactobacillus and increase the incidence of E. coli colonization
in pregnant women40,41. Offspring gut microbiota was also
largely altered by AB treatment with increased abundance of
Firmicutes (Lachnospiraceae and Erysipelotrichaceae) and
Proteobacteria, and decreased abundance of Bacteroidetes
(S24-7, Prevotellaceae and Rikenellaceae) and Lactobacillaceae.
In a recent mouse study12, early life low-dose penicillin also
reduced the abundance of Lactobacillaceae and Rikenellaceae
which were considered potential protective candidates against
long-lasting metabolic disturbances. In another mouse study42,
the increased relative abundance of Lachnospiraceae and
decreased level of S24-7 observed at weaning were shown to
predict diabetes and immune status later in life. We therefore
hypothesize that some of these bacterial changes induced by
early life AB could be involved in long-lasting behavioural
alterations. Similar to dams, and as previously reported in other
studies25,43, we observed, in AB-treated mice, a large increase
in Proteobacteria due to increased penicillin-resistant
Enterobacteriaceae family44, a potential source of
lipopolysaccharides (endotoxins that can elicit strong immune
responses in the host). Supplementation with Lactobacillus
JB-1 partially counteracted the AB-induced increase in
Enterobacteriaceae; we speculate that this may be due to JB-1
secreting short-chain fatty acids that affect the luminal pH45and
thus creating a non-permissive environment for the growth ofEnterobactericeae. JB-1 supplementation also prevented the
changes in S24-7, Lachnospiraceae and Erysipelotrichaceae.
Nevertheless, the overall effects of JB-1 supplementation on
penicillin-induced dysbiosis were modest.
Importantly, the drastic dysbiosis induced by AB observed at
PND21 was still present at PND42, even after 3 weeks cessation of
AB. However, it was not associated with changes in gut barrier
integrity or gut inflammation. This is consistent with results
obtained by Savage and Dubos46who observed no histological
damage of intestinal mucosa following penicillin treatment.
Changes in microbial composition induced by early life AB
treatment were accompanied by significant behavioural changes
unlikely attributable to a direct toxic effect of penicillin on the
brain since (1) penetration of penicillin into the CSF is very low
in the absence of infection47and (2) the renal clearance of
penicillin V is very rapid47. Further, AB treatment was stopped 3
weeks before beginning behavioural assessment. Future research
could test potential direct effects of penicillin on the host by
transferring faecal microbiota from AB-treated animals to germ-
free mice and subsequent behavioural assessment; however, this
procedure has several limitations48. The behavioural changes
consisted mainly in decreased anxiety and social behaviour,
reduced preference for social novelty and a surprising aggressive
behaviour with preservation of general locomotor activity.
Maternal care, that could play a role in shaping behaviour in
adulthood, was not assessed in this current study. However, nests
were carefully checked and no abnormalities or cannibalism
occurred, suggesting that intestinal dysbiosis of dams did not
affect maternal care, which is in line with a previous report by
Sudo et al.21who did not find any effect of germ-free status on
maternal behaviour.
While the gut microbial structure was similar between males
and females, we found a sex effect regarding some behavioural
data. A previous study, performed in germ-free mice, showed that
CNS alterations occurred in a sex-specific manner and that
reconstitution of a normal microbiota restored anxiety-like
behaviour in males but not in females49. In our current study,
anxiety-like behaviour was reduced in males treated with AB but
not in females, while concurrent supplementation with JB-1
decreased anxiety in females but was associated with normal
anxiety level in males. It has been previously shown that, in
healthy adult BALB/c males, supplementation with JB-1 resulted
in decreased anxiety levels and depression-like behaviour32. These
JB-1-induced emotional changes were mediated by the vagus
nerve, since vagotomized mice treated with JB-1 did not show
such changes. No data are currently available on the effect of JB-1
on female mice with intact vagus nerves. Overall, our results
highlight the fact that males and females do not always respond
similarly to treatment and reinforce the importance of
investigating sex differences in rodent studies. The mechanisms
surrounding the sex differences in behaviour are not well
understood. While oestrous cycle hormones could play a role, it
is possible that other, yet unidentified, immunological or
neuroendocrine factors or bacterial metabolites potentially
influencing the vagus nerve could be at the origin of sex
difference in the behavioural response to AB and JB-1 treatments.
Faecal and blood metabolomic analysis as well as vagus nerve
intervention could be tested in future studies to explore this
possibility.
Reduced anxiety and social behaviour have been reported in
germ-free mice22,23as well as in adult mice receiving a mixture of
non-absorbable antimicrobials24. In the latter study, after a
2-week AB-washout period, the anxiolytic behaviour returned to
normal. In our current study, even after 3 weeks of antibiotic
cessation, mice still exhibited significant behavioural and social
alterations suggesting that the pre-weaning bacterial colonizationARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15062
8 NATURE COMMUNICATIONS | 8:15062 | DOI: 10.1038/ncomms15062 | www.nature.com/naturecommunications

is important to durably establish certain behaviours, as suggested
previously23.
Interestingly, we found that some of the AB-treated mice
exhibited aggressive behaviour in the resident-intruder paradigmand spent more time interacting with the CD-1 aggressor. The
microdefeat protocol has been validated for C57BL/6 males and,
under control conditions, that is, when a naive C57BL/6 is
subjected to microdefeat in the absence of other manipulation, it
does not result in social avoidance behaviour50. To our
knowledge, the microdefeat model has not been tested before in
the more anxious BALB/c strain. However, a short version of
chronic social defeat demonstrated that BALB/c spent less time
interacting with the CD-1 aggressor mouse51compared to
C57BL/6 mice. We found that, under control conditions, almost
all untreated BALB/c were defeated and clearly avoided the CD-1
aggressor, while almost half of the AB-treated BALB/c were not
socially defeated and indeed interacted with the aggressor. These
aggressive AB-treated mice were characterized by a large increase
in the expression of Avpr1b in the frontal cortex. Avpr1b is
known to be involved in social and aggressive behaviours since
deletion of this gene or administration of an Avpr1b antagonist to
males promotes reduced aggressive behaviour35,52. Females were
not tested for aggressive behaviour in our study for ethical
reasons53, but interestingly they also exhibited high levels of
Avpr1b in the brain. Aggressive behaviour in AB-treated females
needs to be explored in future studies.
The BBB begins to develop during intrauterine life and
continues to mature during early postnatal stages54. The BBB
protects against exposure to bacterial metabolites and potential
toxins coming from the blood. TJ proteins that appear in the
endothelium around embryonic days E11 to E13 (ref. 54) are
mainly responsible for the barrier properties and are also
functionally dependent on the presence of gut bacteria30. In our
study, AB exposure of fetus started at E12–E14, a period which
overlaps with the developmental window of TJ protein formation.
Surprisingly and by contrast to germ-free mice, early-life AB
treatment was associated with a reinforcement of BBB integrity asdemonstrated by increased mRNA and protein expressions of
occludin and claudin-5 in the hippocampus, but not in the frontal
cortex. Since inflammatory cytokines are known to induce
behavioural and cognitive impairments, we speculate that the
reinforcement of BBB integrity may have prevented the
production of inflammatory cytokines in the hippocampus, and
that might be a protective mechanism to preserve hippocampal-
dependent tasks like learning and memory. By contrast, AB
treatment induced a large increase in specific cytokines
and chemokine in the frontal cortex of both sexes. Previous
studies55–57have shown that chronic stress induces anxiety-like
behaviour that was associated with increase in Ly6Chimonocytes
trafficking to the frontal cortex, increased brain expression of
IL-1band TNF a, and reduced IL-10, suggesting a pro-
inflammatory state. However, Mo ¨hleet al.58recently reported
that antibiotic treatment decreased the number of brain Ly6Chi
monocytes, which was associated with decreased neurogenesis.Supplementation with probiotics and physical exercise were able
to restore hippocampal neurogenesis by increasing the number of
Ly6Chimonocytes in the brain. Consequently, increased influx of
brain Ly6Chimonocytes, an important cell population serving as
mediator between the periphery and the brain, was considered to
be a beneficial response to ensure neurogenesis. Other studies
have also emphasized the neuroprotective functions of bone
marrow-derived microglia in Alzheimer’s disease59and in other
brain diseases where infiltrating monocytes-derived macrophages
could become resolving cells and secrete anti-inflammatory
cytokines60. We did not assess the number of Ly6Chi
monocytes in our study but cytokines IL-6, IL-10 andchemokine Cxcl15 (IL-8) were significantly increased in the
frontal cortex of mice treated with AB, whereas TNF aand IL-1 b,
the two main markers of the pro-inflammatory response, were
not changed. IL-6 has a dichotomous action in the brain withboth pro- and anti-inflammatory function helping to maintain
BBB integrity61,62. We found strong positive correlations between
occludin and IL-6 in the frontal cortex that could suggest a
beneficial effect of IL-6 in preserving BBB integrity. IL-10 is a
typical anti-inflammatory cytokine. Intracerebroventricular
administration of IL-10 almost completely inhibits LPS-induced
brain TNF aand IL-1 bproduction while IL-6 expression is not
affected63. In our study, it is plausible that IL-10 induction
promoted a negative feedback on pro-inflammatory TNF aand
IL-1bin the frontal cortex. The role of Cxcl15 in the brain has
received little attention but has been shown to stimulate
the production of neurotrophic factors64. We speculate that the
change in cytokines expression that we found in the frontal cortex
of AB-treated mice does not represent a typical pro-inflammatory
status but could be a specific response of the brain to cope with
early life AB treatment. Furthermore, immune examination of
serum, ileum and colon from treated mice revealed no evidence of
any systemic or peripheral inflammatory changes suggesting that
brain cytokines upregulation induced by AB is a localized
response. Finally, vasopressin and its receptor Avpr1b have been
shown to exacerbate the production of brain inflammatory
cytokines and chemokines36,65. In our study, we found
correlations between Avpr1b and IL-6, IL-10 and Cxcl15 in the
frontal cortex of both males and females, but not the
hippocampus, suggesting that Avpr1b, in addition to being
involved in social and aggressive behaviours, could also be
involved in the regulation of brain cytokines expression.
While all these data obtained in rodents cannot be directly
extrapolated to humans, they add support to the necessity to
carefully consider the potential negative long-term effects of
early-life AB exposure. The lasting dysbiosis and the persistence
of cytokine change in the frontal cortex associated with
aggression and reduced social interactions and anxiety raisequestions regarding the important role of this brain area in the
development of autism and other neuropsychiatric disorders.
The partial preventive effects of a Lactobacillus given concur-
rently with the AB early in life are intriguing and warrant further
investigation of their potential to attenuate some of these possibly
noxious long-term effects.
Methods
Study design .Male and female BALB/c mice (breeding pairs), 6–8 weeks old, were
acquired from Charles River (Montreal, QC, Canada) and allowed to acclimatize in
the housing facility for at least 1 week. Breeding of mice was organized as follows: asingle female mouse was placed in the male’s cage for 48 h. Pregnancy was
confirmed by increased weight ( 43 g within 8 days following mating). One week
before delivery, pregnant females were housed singly with nesting material andtreatment (Tx) was started (number of days of Tx before delivery ¼7.3±1.1).
Pregnant females were treated with either drinking water (control group defined as
CT,n¼5) or penicillin V (antibiotic group defined as AB, n¼4) or penicillin V
andLactobacillus rhamnosus JB-1 (defined as AB/JB1, n¼3) until weaning of pups
(postnatal day 21). Pups were therefore exposed to the treatment prenatally and
during the early postnatal life. This period is referred to as ‘early life’ in the
description of the results. Since the dams were the animals treated and not the
pups, it was impossible to randomly assign the pups to a treatment group. Atweaning, male and female offspring were separated from the dams and housed
3–5 per cage and received regular drinking water and standard rodent chow ad
libitum . A battery of behavioural tests was started when the offspring reached
6-weeks old (postnatal day 42), with 2 days of rest between each test. The
microdefeat was performed at the end of the experiment, only in males. Mice were
killed by decapitation the day following the last test in order to collect trunk blood
and tissue samples. A total of 72 mice were used in this study (Fig. 1). Sample size
of this exploratory study could not be calculated here as the effect size wasunknown. For the microdefeat paradigm, male CD-1 retired breeders were
obtained from Charles River. As per our ethical approval, only male mice were used
in the social defeat experiments. All animals were housed under 12 h light/12 hNATURE COMMUNICATIONS | DOI: 10.1038/ncomms15062 ARTICLE
NATURE COMMUNICATIONS | 8:15062 | DOI: 10.1038/ncomms15062 | www.nature.com/naturecommunications 9

dark cycle. All experiments followed the guidelines of the Canadian Council on
Animal Care and were approved by the McMaster Animal Research Ethics Board.
Treatment with antibiotic and L. rhamnosus JB-1.Dams received AB and
L. rhamnosus JB-1 treatments through the drinking water in order to avoid stress
induced by oral gavage. AB treatment consisted in penicillin V (Sigma-Aldrich,MO, USA) that is absorbable by the gastro-intestinal tract66and found in breast
milk39. Penicillin V crosses placenta and passes into fetal circulation47. Dams
received a low dose of penicillin V that, in our opinion, is clinically relevant(50,000 U kg/C01per day or 31 mg kg/C01per day)47,67. Since water consumption
increases significantly during the gestational and lactating periods and is influenced
by the number of pups per litter, the dose of penicillin V was adjusted to body
weight and water consumption of dams, measured twice weekly. L. rhamnosus JB-1
was obtained as a gift from Alimentary Health, Cork, Ireland and is the samebacterial strain we have used previously32. It was also administered in drinking
water (109c.f.u. per day) in which it remains viable for more than 12 h. Dams
from the AB group received regular water during the day (9:00 to 18:00) andpenicillin V during the night (18:00 to 9:00). Dams from AB/JB1 group received
L. rhamnosus JB-1 during the day and penicillin V during the night. This schedule,
reported in a previous study27, has been used to avoid the adverse effect of AB on
the bacteria. We found using quantitative PCR that L. rhamnosus was detectable in
faeces of all dams before treatment and only in dams of the AB/JB1 group aftertreatment (Supplementary Fig. 20), proving that the protocol using two separated
drinking bottles alternately, is efficient in maintaining the presence of some
L. rhamnosus in the gut. All bottles of water containing bacteria were shaken three
times per day.
Behavioural testing.All behavioural tests were recorded by a video camera or
connected to a computer and data analysis was performed by using Motor Monitor
software (Kinder Scientific, Poway, CA) or EthoVision XT software (Noldus,
Leesburg, VA). The experimenter was not blinded to the group allocation whenassessing behaviour.
Open field. Mice were tested during the dark phase under dim-light conditions.
After a 1 h period of habituation in the testing room, animals were placed in theenclosure for 30 min. Distance moved in the open field and rearing were recorded
using Motor Monitor software. The apparatus was thoroughly cleaned with water
and dried between each animal.
Three-chamber sociability test. Mice were tested in the three-chamber apparatus
during the light phase, following a 30 min period of habituation in the testing room.
The apparatus consists of three rectangular Plexiglas chambers whose dividing walls
possess small openings that allow access into each chamber. The experimental mouse
was first placed in the centre chamber while the doorways were closed and allowed toexplore for a 5-min habituation period. In the second phase of the test, an unfamiliar
mouse (strain- and sex-matched) was placed within an inverted wire cup in one of
the outer chambers while an empty wire cup was placed in the other outer chamber.The doors to the outer chambers were opened and the sociability trial was conducted
for 10 min during which the experimental mouse was allowed to explore the three
chambers. Time spent in each chamber was recorded by a video camera positioned
over the apparatus and analysed by using EthoVision XT software. Sociability is
defined as the experimental mouse spending more time in the chamber containingthe novel mouse than in the chamber containing the novel object. In the third phase
of the test, a second novel mouse (stranger 2) is placed inside the previously empty
wire cup while the initial novel mouse (stranger 1) remains inside its cup. Theexperimental mouse is given 10 min to explore all the three chambers. Preference for
social novelty is defined as more time spent in the chamber with stranger 2 than time
spent in the chamber with stranger 1. The apparatus was thoroughly cleaned withwater and dried between each animal.
Elevated plus maze. Mice were tested in the EPM apparatus that is elevated at
76 cm off the ground, consists of four arms—two open arms and two closed arms
made with black Plexiglas walls. Mice were transported to the behavioural testing
room for a 30 min habituation period. The mouse was then placed in theintersection of the four arms, facing open arm, and allowed to explore for 5 min.
The EPM was connected to a computer and behavioural data were analysed by
using Motor Monitor software. Time spent, distance travelled and number ofentries in the open arms were used to assess anxiety-like behaviour. The apparatus
was thoroughly cleaned with water and dried between each animal.
Microdefeat stress and social avoidance test. The microdefeat paradigm is a
short (acute) version adapted from the chronic social defeat described by
Krishnan et al.
68and by Golden et al.50.The microdefeat is a model that was
developed initially to measure increased susceptibility to stress. It can reveal
susceptible phenotype if an animal’s stress threshold is shifted by the experimental
manipulation. The microdefeat has been described in C57BL/6 male mice only andunder control condition, this protocol does not induce social avoidance. There are
currently no widely accepted versions of microdefeat in females. In our study,
microdefeat has been performed in male BALB/c as follows. First, CD1 aggressors
(retired breeders 44–5 months old) were screened for consistent attack latencies
(o60 s on three consecutive screening sessions with BALB/c intruders called
screeners). CD-1 mice were singly housed throughout the experiment. Successful
application of social defeat stress is dependent on appropriate selection of CD-1
mice with consistent levels of aggressive behaviour. Within the same day, BALB/cmice are forced to intrude into the space territorialized by the larger and aggressive
CD-1 mouse for three sessions of 3 min, followed by a rest period 15 min in the
home cage between each exposure. This situation leads to intruder aggression andsubordination. After the last resident–intruder session, BALB/c mice are housed
singly (with free access of food and water) and a wound score (0: absent, 1: light,
2: moderate, 3: severe) was assigned. BALB/c mice were tested for social avoidance
24 h later. Social avoidance test was performed in a rectangular Plexiglass box,
where an unfamiliar CD-1 aggressor was placed under a wire cage at one end of thearena. The box was virtually split into two parts, an interaction zone (close to the
wire cage) and a non-interaction zone at the other end of the arena. The BALB/c
mouse was allowed to explore the arena for a first trial of 150 s when the aggressorwas absent (empty wire cage) and then for a second period of 150 s when the
aggressor was present. A social interaction ratio was calculated as follows: 100 /C2
(time spent in the interaction zone when the aggressor is present/time spent in theinteraction zone when the aggressor is absent). Mice with an interaction ratio
o100 were considered susceptible to stress while mice with an interaction ratio
4100 were resilient to stress. Results were analysed by using EthoVision XT
software.
RNA extraction and RT–qPCR analysis
.After decapitation of animals, gut (distal
ileum and colon) and brain (frontal cortex and hippocampus) were quickly
dissected and put into RNA later solution (Ambion, Life Technologies, CA, USA).
Tissues were incubated overnight at 4 /C176C then transferred at /C020/C176C until further
processed. Following tissue homogenization, total RNA was extracted using TRIzolReagent (Ambion, Life Technologies). One microgram RNA was then converted
into cDNA using SuperscriptIII First-Strand Synthesis Supermix (Invitrogen, CA,
USA). Diluted or non-diluted cDNA was used as template for qPCR reaction usingPowerUp SYBR Green Master Mix (Applied Biosystem, Life Techologies, TX,
USA) containing ROX dye Passive Reference. The qPCR reactions were performed
in the fast mode (UDG activation 50 /C176C, 2 min; Dual-Lock DNA polymerase 95 /C176C,
2 min; denaturation: 95 /C176C, 1 s; annealing/extension 60 /C176C, 30 s; number of cycles:
40–50) by using QuanStudio3 machine (Applied Biosystem). Data were normalizedto the endogenous control GAPDH and the relative quantification was analysed
using the DDCt method. The experimental treatments did not affect GAPDH
expression in any of the tested tissues (Supplementary Fig. 21). Primers weredesigned with Primer Express Software and used at a concentration of 300 nM.
Primer sequences are listed in Supplementary Table 6.
Western blotting
.Brain tissues (hippocampus and frontal cortex) were quickly
dissected following decapitation and stored at /C080/C176C. Samples were homogenized
and lysed (45 min on ice) in protein lysis buffer (100 ml per 10 mg; 0.05 M Tris-HCl,
0.15 M Nacl, pH 7.4) containing 1% Triton X-100, 1 mM EDTA, 10 mM NaF, 0.5%
sodium deoxycholate, 0.1% SDS, 1 mM PMSF, 1 mM Na 3VO 4and protease inhi-
bitor cocktail (1 tablet per 10 ml, cOmplete Roche, Sigma-Aldrich) and centrifuged
at 15,000 gfor 10 min at 4 /C176C. The supernatant was collected and protein con-
centration was measured by the Lowry method (DC Protein Assay, Biorad). Pro-
teins (20 mg) were fractionated on a 12% SDS–polyacrylamide gel electrophoresis
gel and transferred to 0.2 mm polyvinylidene difluoride membranes (GE Healthcare
Life Sciences, Germany). Membranes were blocked in 0.1% Tween-TBS 20 with 5%
nonfat dry milk for 1 h at room temperature, then probed with rabbit antibodies to
occludin (Invitrogen 40–4700, 1:1,000, overnight, 4 /C176C), claudin-5 (Invitrogen
34-1600, 1:1,000, overnight, 4 /C176C) or b-actin (Bioss bs-0061R, 1:5,000, 2 h, room
temperature). After extensive washing, membranes were incubated for 1 h at room
temperature with a goat anti-rabbit IgG-peroxidase secondary antibody (Invitrogen
A0454, 1:20,000), then visualized with Amersham ECL western blotting detection
reagents (GE Healthcare Life Sciences) and developed in the dark room.Densitometry was quantified with Image J69.
Assessment of intestinal barrier permeability .Evaluation of intestinal barrier
integrity was performed by measuring the mRNA expression of tight junction
proteins occludin and zonula-occludens 1 (ZO-1), two key markers of paracellular
permeability70, in ileum and colon and by the faecal albumin concentration. The
latter is a good indicator of disrupted intestinal barrier function and has beenshown to be comparable and correlate well with the orally administered
FITC-dextran method71. Faecal albumin was determined by ELISA (Bethyl Labs,
TX, USA) following manufacturer’s guidelines.
Serum cytokine assays .Trunk blood was collected into sterile tubes, allowed to
clot at room temperature, spun down for 10 min at 850 gand serum was stored at
/C080/C176C. Cytokines were analysed by using the mouse cytokine 32-plex discovery
assay (Eve technologies, AB, Canada).
16S rRNA gene sequence analysis .Stool samples were collected in sterile tubes and
stored at /C080/C176C until further analysis. DNA from 176 stool samples was extracted
using the PowerSoil HTP DNA Isolation Kit (MoBio, USA) according to the
manufacturer’s instructions with a beadbeater (BioSpec, USA) set on high for 2 min.
Following DNA extraction, the V4 variab le region of the bacterial 16S rRNA geneARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15062
10 NATURE COMMUNICATIONS | 8:15062 | DOI: 10.1038/ncomms15062 | www.nature.com/naturecommunications

was amplified by PCR using the 515F and 806R (each well received a separate 515F
barcoded primer). 515F- (barcode) 50-AATGATACGGCGACCACCGAGATCTAC
ACGCTAGCCTTCGTCGCTATGGTAA TTGTGTGYCAGCMGCCGCGGTAA-30
and 806R 50-CAAGCAGAAGACGGCATACGAGATAGTCAGTCAGCCGGAC
TACHVGGGTWTCTAAT-30(ref. 72). PCR reactions were carried out with the
Primestar taq polymerase (Takara, Ja pan) for 30 cycles of denaturation (95 /C176C),
annealing (55 /C176C) and extension (72 /C176C), and a final elongation at 72 /C176C. Products were
purified using AMPure magnetic beads (Bec kman Coulter, USA) and quantified using
Pico-green dsDNA quantitat ion kit (Invitrogen, USA). S amples were then pooled at
equal concentrations (50 ng ml/C01), loaded on 2% E-Gel (Thermo Fisher, USA) and
purified using NucleoSpin Gel and PCR Cl ean-up (Macherey-Nagel, Germany).
Purified products were sequenced using the Illumina MiSeq platform (Genomic Center,
Faculty of Medicine, BIU, Israel). Data analysis was performed using the QuantitativeInsights into Microbial Ecology (QIIME) pipel ine version 1.8.0 (refs 72,73). Paired-end
sequences were joined using fastq-join, demultiplexed and quality filtered with an
average quality threshold of 25. Chimeric sequences were identified using USEARCHand removed, and reads were clustered into OTUs using the open reference UCLUST
method against the GreenGenes 08/13 database
74, with a cutoff of 97% sequence
identity. Core OTUs were calculated by filtering for OTUs presents in at least 50% ofsubjects in the same treatment group. Analyses were performed on the core OTUs using
a rarefied table of 10,200 sequences per s ample. In addition, alpha diversity was
estimated using Faith’s phylogenetic diversity (PD whole tree) and beta diversity was
calculated using weighted and unweighted UniFrac75. Significance between groups for
distances was assessed using t-tests as implemented in ‘make_distances_boxplots.py’
script in QIIME 1.8.0.
Statistical analysis .Results of behavioural tests were analysed by a two-way
ANOVA with sex (male versus female) and treatment (CT, AB, AB/JB1) as
between factors. Homogeneity of variance was tested with Levene’s test. When thesex/C2treatment interaction was significant, post hoc tests using Bonferroni
correction were performed. Analysis of the bacterial relative abundance in dams
and offspring was performed by using mixed ANOVA with time (T0, T1, T2 or
PND21, PND42) as a within-factor (repeated measure) and treatment (CT, AB,
AB/JB1) as a between-factor. For the dams, assumption of sphericity was checkedwith Mauchly’s test and Greenhouse–Geisser correction was applied to produce a
valid F-ratio when condition of sphericity was not met. For the offspring, homo-
geneity of variances for each combination of the groups (time and treatment) waschecked with Levene’s test. If the time /C2treatment interaction was significant, post
hoctests were performed with Bonferonni correction (when homogeneity of
variances was met) or with Games–Howell procedure (when homogeneity of
variances was not assumed). Significant outliers were identified graphically (with
boxplot) and by using the ‘studentized residual’. Since males have been subjected tothe social defeat while females have not been stressed, males and females were
analysed separately regarding the biological assays (serum, gut and brain samples)
by using one-way ANOVA (or Kruskal–Wallis test if assumptions of normality andhomoscedasticity were not met). Tukey post hoc tests were performed for pairwise
comparisons. Results were considered statistically significant when Po0.05. All
tests were two-tailed. Statistics were performed with SPSS 23.0.
Data availability
.The 16S rRNA gene sequence data have been deposited in the
European Bioinformatics Institute (EBI) database with accession code ERP021539.
The authors declare that all other relevant data supporting the findings of thisstudy are available within the paper and its Supplementary Information files, or
from the corresponding authors on request.
References
1. Chai, G. et al. Trends of outpatient prescription drug utilization in US children,
2002–2010. Pediatrics 130, 23–31 (2012).
2. Blaser, M. J. Missing Microbes: how the Overuse of Antibiotics Is Fueling Our
Modern Plagues (Henry Holt and Co., 2014).
3. Stensballe, L. G., Simonsen, J., Jensen, S. M., Bønnelykke, K. & Bisgaard, H. Use
of antibiotics during pregnancy increases the risk of asthma in early childhood.J. Pediatr. 162, 832–838.e3 (2013).
4. Kummeling, I. et al. Early life exposure to antibiotics and the subsequent
development of eczema, wheeze, and allergic sensitization in the first 2 years of
life: the KOALA Birth Cohort Study. Pediatrics 119, e225–e231 (2007).
5. Kozyrskyj, A. L., Ernst, P. & Becker, A. B. Increased risk of childhood asthma
from antibiotic use in early life. Chest 131, 1753–1759 (2007).
6. McKeever, T. M. et al. Early exposure to infections and antibiotics and the
incidence of allergic disease: a birth cohort study with the West Midlands
General Practice Research Database. J. Allergy Clin. Immunol. 109, 43–50
(2002).
7. Hviid, A., Svanstro ¨m, H. & Frisch, M. Antibiotic use and inflammatory bowel
diseases in childhood. Gut60,49–54 (2011).
8. Trasande, L. et al. Infant antibiotic exposures and early-life body mass. Int. J.
Obes. 37,16–23 (2013).
9. Bailey, L. C. et al. Association of antibiotics in infancy with early childhood
obesity. JAMA Pediatr. 168, 1063–1069 (2014).10. Slykerman, R. F. et al. Antibiotics in the first year of life and subsequent
neurocognitive outcomes. Acta Paediatr. 106, 87–94 (2017).
11. Russell, S. L. et al. Perinatal antibiotic treatment affects murine microbiota,
immune responses and allergic asthma. Gut Microbes 4,158–164 (2013).
12. Cox, L. M. et al. Altering the intestinal microbiota during a critical
developmental window has lasting metabolic consequences. Cell158, 705–721
(2014).
13. Russell, S. L. et al. Early life antibiotic-driven changes in microbiota enhance
susceptibility to allergic asthma. EMBO Rep. 13,440–447 (2012).
14. Cryan, J. F. & Dinan, T. G. Mind-altering microorganisms: the impact
of the gut microbiota on brain and behaviour. Nat. Rev. Neurosci. 13,701–712
(2012).
15. Forsythe, P., Kunze, W. & Bienenstock, J. Moody microbes or fecal phrenology:
what do we know about the microbiota-gut-brain axis? BMC Med. 14,58
(2016).
16. Collins, S. M., Surette, M. & Bercik, P. The interplay between the intestinal
microbiota and the brain.
Nat. Rev. Microbiol. 10,735–742 (2012).
17. Lyte, M. Microbial endocrinology in the microbiome-gut-brain axis: how
bacterial production and utilization of neurochemicals influence behavior. PLoS
Pathog. 9,e1003726 (2013).
18. Braniste, V. et al. The gut microbiota influences blood-brain barrier
permeability in mice. Sci. Transl. Med. 6,263ra158 (2014).
19. Erny, D. et al. Host microbiota constantly control maturation and function of
microglia in the CNS. Nat. Neurosci. 18,965–977 (2015).
20. Hoban, A. E. et al. Regulation of prefrontal cortex myelination by the
microbiota. Transl. Psychiatry 6,e774 (2016).
21. Sudo, N. et al. Postnatal microbial colonization programs the hypothalamic-
pituitary-adrenal system for stress response in mice. J. Physiol. 558, 263–275
(2004).
22. Neufeld, K. M., Kang, N., Bienenstock, J. & Foster, J. A. Reduced anxiety-like
behavior and central neurochemical change in germ-free mice.
Neurogastroenterol. Motil. 23,255–264, e119 (2011).
23. Desbonnet, L., Clarke, G., Shanahan, F., Dinan, T. G. & Cryan, J. F. Microbiota
is essential for social development in the mouse. Mol. Psychiatry 19,146–148
(2014).
24. Bercik, P. et al. The intestinal microbiota affect central levels of brain-derived
neurotropic factor and behavior in mice. Gastroenterology 141, 599–609.e3
(2011).
25. Desbonnet, L. et al. Gut microbiota depletion from early adolescence in mice:
implications for brain and behaviour. Brain. Behav. Immun. 48,165–173
(2015).
26. Fro ¨hlich, E. E. et al. Cognitive impairment by antibiotic-induced gut dysbiosis:
analysis of gut microbiota-brain communication. Brain. Behav. Immun. 56,
140–155 (2016).
27. Wang, T. et al. Lactobacillus fermentum NS9 restores the antibiotic induced
physiological and psychological abnormalities in rats. Benef. Microbes 6,
707–717 (2015).
28. Hsiao, E. Y. et al. Microbiota modulate behavioral and physiological
abnormalities associated with neurodevelopmental disorders. Cell155,
1451–1463 (2013).
29. Gareau, M. G. et al. Bacterial infection causes stress-induced memory
dysfunction in mice. Gut60,307–317 (2011).
30. Tillisch, K. et al. Consumption of fermented milk product with probiotic
modulates brain activity. Gastroenterology 144, 1394–1401.e4 (2013).
31. Perez-Burgos, A. et al. Psychoactive bacteria Lactobacillus rhamnosus (JB-1)
elicits rapid frequency facilitation in vagal afferents. Am. J. Physiol. Gastrointest.
Liver Physiol. 304, G211–G220 (2013).
32. Bravo, J. A. et al. Ingestion of Lactobacillus strain regulates emotional behavior
and central GABA receptor expression in a mouse via the vagus nerve. Proc.
Natl Acad. Sci. USA 108, 16050–16055 (2011).
33. Schuch, J. J. J., Roest, A. M., Nolen, W. A., Penninx, B. W. J. H. & de Jonge, P.
Gender differences in major depressive disorder: results from the Netherlands
study of depression and anxiety. J. Affect. Disord. 156, 156–163 (2014).
34. Walf, A. A. & Frye, C. A. The use of the elevated plus maze as an assay of
anxiety-related behavior in rodents. Nat. Protoc. 2,322–328 (2007).
35. Wersinger, S. R., Ginns, E. I., O’Carroll, A.-M., Lolait, S. J. & Young, W. S.
Vasopressin V1b receptor knockout reduces aggressive behavior in male mice.
Mol. Psychiatry 7,975–984 (2002).
36. Szmydynger-Chodobska, J., Gandy, J. R., Varone, A., Shan, R. & Chodobski, A.
Synergistic interactions between cytokines and AVP at the blood-CSF barrier
result in increased chemokine production and augmented influx of leukocytesafter brain injury. PLoS ONE 8,e79328 (2013).
37. Biesmans, S. et al. Systemic immune activation leads to neuroinflammation and
sickness behavior in mice. Mediators Inflamm. 2013, 1–14 (2013).
38. Schedlowski, M., Engler, H. & Grigoleit, J.-S. Endotoxin-induced experimental
systemic inflammation in humans: a model to disentangle immune-to-brain
communication. Brain. Behav. Immun. 35,1–8 (2014).NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15062 ARTICLE
NATURE COMMUNICATIONS | 8:15062 | DOI: 10.1038/ncomms15062 | www.nature.com/naturecommunications 11

39. Anderson, P. O. Drugs and breast feeding—a review. Ann. Pharmacother. 11,
208–223 (1977).
40. Tempera, G. et al. The impact of prulifloxacin on vaginal lactobacillus
microflora: an in vivo study. J. Chemother. 21,646–650 (2009).
41. Stokholm, J. et al. Antibiotic use during pregnancy alters the commensal
vaginal microbiota. Clin. Microbiol. Infect. 20,629–635 (2014).
42. Krych, Ł., Nielsen, D. S., Hansen, A. K. & Hansen, C. H. F. Gut microbial
markers are associated with diabetes onset, regulatory imbalance, and IFN- g
level in NOD mice. Gut Microbes 6,101–109 (2015).
43. Candon, S. et al. Antibiotics in early life alter the gut microbiome and increase
disease incidence in a spontaneous mouse model of autoimmune insulin-
dependent diabetes. PLoS ONE 10,e0125448 (2015).
44. Paterson, D. L. Resistance in gram-negative bacteria: enterobacteriaceae. Am. J.
Med. 119, S20–S28 (2006).
45. Veiga, P. et al. Bifidobacterium animalis subsp. lactis fermented milk product
reduces inflammation by altering a niche for colitogenic microbes. Proc. Natl
Acad. Sci. USA 107, 18132–18137 (2010).
46. Savage, D. C. & Dubos, R. Alterations in the mouse cecum and its flora
produced by antibacterial drugs. J. Exp. Med. 128, 97–110 (1968).
47. Grayson, M. L. et al. Kucers’ The Use of Antibiotics Sixth Edition: a Clinical
Review of Antibacterial, Antifungal and Antiviral Drugs. (CRC Press, 2010).
48. Arrieta, M.-C., Walter, J. & Finlay, B. B. Human microbiota-associated mice: a
model with challenges. Cell Host Microbe 19,575–578 (2016).
49. Clarke, G. et al. The microbiome-gut-brain axis during early life regulates the
hippocampal serotonergic system in a sex-dependent manner. Mol. Psychiatry
18,666–673 (2013).
50. Golden, S. A. et al. Epigenetic regulation of RAC1 induces synaptic remodeling
in stress disorders and depression. Nat. Med. 19,337–344 (2013).
51. Savignac, H. M. et al. Increased sensitivity to the effects of chronic social defeat
stress in an innately anxious mouse strain. Neuroscience 192, 524–536 (2011).
52. Blanchard, R. J. et al. AVP V1b selective antagonist SSR149415 blocks aggressive
behaviors in hamsters. Pharmacol. Biochem. Behav. 80,189–194 (2005).
53. Trainor, B. C. et al. Sex differences in social interaction behavior following
social defeat stress in the monogamous California mouse ( Peromyscus
californicus ).PLoS ONE 6,e17405 (2011).
54. Wolburg, H. & Lippoldt, A. Tight junctions of the blood–brain barrier:
development, composition and regulation. Vascul. Pharmacol. 38,323–337 (2002).
55. Wohleb, E. S., Powell, N. D., Godbout, J. P. & Sheridan, J. F. Stress-induced
recruitment of bone marrow-derived monocytes to the brain promotes anxiety-like behavior. J. Neurosci. Off. J. Soc. Neurosci. 33,13820–13833 (2013).
56. Wohleb, E. S. et al. Re-establishment of anxiety in stress-sensitized mice is
caused by monocyte trafficking from the spleen to the brain. Biol. Psychiatry 75,
970–981 (2014).
57. Voorhees, J. L. et al. Prolonged restraint stress increases IL-6, reduces IL-10,
and causes persistent depressive-like behavior that is reversed by recombinant
IL-10. PLoS ONE 8,e58488 (2013).
58. Mo ¨hle, L. et al. Ly6Chi monocytes provide a link between antibiotic-induced
changes in gut microbiota and adult hippocampal neurogenesis. Cell Rep. 15,
1945–1956 (2016).
59. Naert, G. & Rivest, S. A deficiency in CCR2 țmonocytes: the hidden side of
Alzheimer’s disease. J. Mol. Cell Biol. 5,284–293 (2013).
60. Shechter, R. & Schwartz, M. Harnessing monocyte-derived macrophages to
control central nervous system pathologies: no longer ‘if’ but ‘how’. J. Pathol.
229, 332–346 (2013).
61. Spooren, A. et al. Interleukin-6, a mental cytokine. Brain Res. Rev. 67,157–183
(2011).
62. Milner, R. & Campbell, I. L. Increased expression of the beta4 and alpha5
integrin subunits in cerebral blood vessels of transgenic mice chronically
producing the pro-inflammatory cytokines IL-6 or IFN-alpha in the centralnervous system. Mol. Cell. Neurosci. 33,429–440 (2006).
63. Di Santo, E. et al. lnterleukin-10 inhibits lipopolysaccharide-induced tumor
necrosis factor and interleukin-1 bproduction in the brain without affecting the
activation of the hypothalamus-pituitary-adrenal axis.Neuroimmunomodulation 2,149–154 (1995).
64. Kossmann, T. et al. Interleukin-8 released into the cerebrospinal fluid after
brain injury is associated with blood-brain barrier dysfunction and nerve
growth factor production. J. Cereb. Blood Flow Metab. 17,280–289 (1997).
65. Szmydynger-Chodobska, J., Fox, L. M., Lynch, K. M., Zink, B. J. & Chodobski, A.
Vasopressin amplifies the production of proinflammatory mediators in traumaticbrain injury. J. Neurotrauma 27,1449–1461 (2010).
66. Welling, P. G. Influence of food and diet on gastrointestinal drug absorption: a
review. J. Pharmacokinet. Biopharm. 5,291–334 (1977).67. Sekirov, I. et al. Antibiotic-induced perturbations of the intestinal microbiota
alter host susceptibility to enteric infection. Infect. Immun. 76,4726–4736
(2008).
68. Krishnan, V. et al. Molecular adaptations underlying susceptibility and
resistance to social defeat in brain reward regions. Cell131, 391–404 (2007).
69. Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25
years of image analysis. Nat. Methods 9,671–675 (2012).
70. Brun, P. et al. Increased intestinal permeability in obese mice: new evidence in
the pathogenesis of nonalcoholic steatohepatitis. Am. J. Physiol. Gastrointest.
Liver Physiol. 292, G518–G525 (2007).
71. Wang, L. et al. Methods to determine intestinal permeability and bacterial
translocation during liver disease. J. Immunol. Methods 421, 44–53 (2015).
72. Caporaso, J. G. et al. Ultra-high-throughput microbial community analysis on
the Illumina HiSeq and MiSeq platforms. ISME J. 6,1621–1624 (2012).
73. Caporaso, J. G. et al. QIIME allows analysis of high-throughput community
sequencing data. Nat. Methods 7,335–336 (2010).
74. DeSantis, T. Z. et al. Greengenes, a chimera-checked 16S rRNA gene database
and workbench compatible with ARB. Appl. Environ. Microbiol. 72,5069–5072
(2006).
75. Lozupone, C. & Knight, R. UniFrac: a new phylogenetic method for comparing
microbial communities. Appl. Environ. Microbiol. 71,8228–8235 (2005).
Acknowledgements
We thank Dr Jane Foster for teaching brain dissection, Dr Karen-Anne McVey Neufeld
for performing biological assay, Dr Mike Surette for his help in DNA extraction andHarman Bathiati for her help collecting tissues during the killing of mice. We also kindlythank Dr Se ´bastien Matamoros for his precious help in bioinformatics, and gratefully
acknowledge Alimentary Health Inc, Cork, Ireland for their generous gift of Lactobacillus
rhamnosus JB-1. We acknowledge grant support from the US Office for Naval Research
(ONR) (N00014-14-1-0787). S.L. is a recipient of a post-doctoral fellowship from theONR and received funds from FSR (Fonds Spe ´cial de la Recherche), Belgium. P.F. and
O.K. are supported by the Canadian-Israel Health Initiative, jointly funded by the
Canadian Institutes of Health Research, the Israel Science Foundation, the InternationalDevelopment Research Centre, Canada and the Azrieli Foundation. L.B.B. is a Post-doctoral Researcher from the F.R.S.-FNRS (Fond National de la Recherche Scientifique,
Belgium).
Author contributions
S.L., P.F. and J.B. conceived and designed the project. S.L. treated mice and performedbehavioural testing, RT–qPCR, western blot and statistical analysis. F.M.M. and A.M.S.
were involved in animal experiments and performed the faecal albumin assay. L.B.B.performed experiments on L. rhamnosus . O.K. and H.B.-A. performed gut microbiota
sequencing and with S.L. and E.C. analysed the microbiome data. S.L., P.F. and J.B.
analysed the data and wrote the manuscript.
Additional information
Supplementary Information accompanies this paper at http://www.nature.com/
naturecommunications
Competing interests: The authors declare no competing financial interests.
Reprints and permission information is available online at http://npg.nature.com/
reprintsandpermissions/
How to cite this article: Leclercq, S. et al. Low-dose penicillin in early life induces
long-term changes in murine gut microbiota, brain cytokines and behavior.Nat. Commun. 8, 15062 doi: 10.1038/ncomms15062 (2017).
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
This work is licensed under a Creative Commons Attribution 4.0
International License. The images or other third party material in this
article are included in the article’s Creative Commons license, unless indicated otherwisein the credit line; if the material is not included under the Creative Commons license,users will need to obtain permission from the license holder to reproduce the material.To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/
rThe Author(s) 2017ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms15062
12 NATURE COMMUNICATIONS | 8:15062 | DOI: 10.1038/ncomms15062 | www.nature.com/naturecommunications