Neuroprotection of lycopene in MSG -intoxication [623376]

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 1 of 31
Lycopene modulate cholinergic dysfunction, Bcl 2/Bax balance and antioxidant
enzymes gene transcripts in monosodium glutamate (E621) – induced
neurotoxicity in a rat model
Sadek, Kadry a *; Abouzed, Tarekb; Nasr, Sherifc
a Department of Biochemistry, Faculty of Veterinary Medicine, Damanhour
University, Egypt
b Department of Bioc hemistry, Faculty of Veterinary Medicine, Kafr El -sheikh
University, Egypt
c Department of Veterinary Genetics and Molecular biology, Faculty of Veterinary
Medicine, Damanhour University, Egypt
* Corresponding author at: Department of Biochemistry, Faculty of Veterinary
Medicine, Damanhour University, Al -Buhiyra Governorate, Egypt. Tel.: +20 10
03695012; fax: +20 45 3591018. E -mail address: [anonimizat]
Running title: Neuroprotection of lycopene in MSG -intoxication
1

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 2 of 31
Abstract
The effect of MSG on brain tissue and the relative ability of lycopene t o avert these
neurotoxic effects were investigated. Thirty -two male Wistar rats were distributed into
four groups. Group I, untreated (placebo); group II, injected with MSG (5 mg kg-1) s.c.;
group III, gastrogavaged with lycopene (10 mg kg-1) p.o. and grou p IV received MSG
with lycopene with the same mentioned doses for 30 days. The results showed that,
MSG induced elevation in lipid peroxidation marker and perturbation in the antioxidant
homeostasis and increased the levels of brain and serum cholinesteras e (ChE), total
creatine phosphokinase (CPK), creatine phosphokinase isoenzymes BB (CPK -BB) and
lactate dehydrogenase (LDH). Glutathione S -transferase (GST), superoxide dismutase
(SOD) and catalase (CAT) activities and gene expression were increased and
glutathione content was reduced in the MSG -challenged rats, and these effects were
ameliorated by lycopene. Furthermore, MSG induced apoptosis in brain tissues
reflected in upregulation of pro -apoptotic Bax while lycopene upregulate the anti –
apoptotic Bcl2. O ur results indicate that lycopene appears to be highly effective in
relieving the toxic effects of MSG by inhibiting lipid peroxidation and inducing
modifications in the activity of cholinesterase and antioxidant pathways. Interestingly,
lycopene protect b rain tissue by inhibiting apoptosis signaling induced by MSG.
Keywords: Monosodium glutamate, lycopene, neurotoxicity, oxidative stress, gene
expression, apoptosis.
2

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official version of record. Page 3 of 31
1. Introduction
Nowadays, most people often eat convenient processed food obtained from
supermarkets rather than preparing it at home. Many of these processed foods have at
least one or two additives or preservatives. More than 3000 additives and preservatives
used commer cially. Additives are defined as any substance that, directly or indirectly
affecting the characteristics of food. Although, the consumers fear about use of these
additives, other reports consider this fearing unjustifiable (Moore 2003). However,
there is a long list of the many pathological hazardous effects of using such additives,
including respiratory symptoms, allergic reactions, alimentary disorders, and others
(Dalton 2002). Synthetic flavor enhancers, the biggest class of additives, acting to
amelio rate the flavor of foods. Glutamate is a non essential amino acid present in many
proteins and distributed in different tissues. Glutamate plays an important role as a
neurotransmitter and in the metabolic process (Fernstrom 2000). Monosodium
glutamate (E6 21; MSG) is the sodium salt of glutamate in which it contains about 78%
glutamic acid and 22% sodium and water (Fernstrom 2000). MSG is used as food
additive especially as a flavor enhancer (Alao et al. 2010). The same authors reported
that, MSG is usually used in protein -rich foods, oriental foods, and soups to enhance
the perception of other tastes, particularly meat, Indomie Noodles and chips. There
were controversy reports locally and globally about the safely uses of MSG. Although
the anecdotal reports of MSG alarming headaches or even asthma, there is a general
consensus from reputable international organizations and nutritionists confirming the
safe uses of MSG at permissible levels (Branen 2002). Although MSG improving taste
of food, previous studies report its harmful effects on brain and testes of human and
animals (Eweka and Adjene 2007). MSG’s toxic effects
3

Can. J. Physiol. Pharmacol. Downloaded from www.nrc researchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 4 of 31
on the male sex organ include causing a significant decrease in sperm count and
increased the percent of sperm abnormality in a dose -dependent manner in male rats. It
was reported that, MSG produces free radicals and reactive oxygen species (ROS;
Pavlovic et al. 2007). The levels of ROS are regulated by a variety of cellular defense
mechanisms consisting of enzymic and non -enzymic antioxidants (El -Baher 2013).
The primary scavenger enzymes involved in detoxifying ROS in mammalian systems
are CAT, SOD, GPX a nd GST (MatEs et al. 1999). Oxidative stress often causes cell
death via apoptosis that is regulated by certain functional genes and their protein
products, among them Bcl -2 and Bax proteins. The balance between Bcl -2 (anti –
apoptosis) and Bax (pro -apoptoti c) proteins determine tissue homeostasis. Bcl -2,
which is an integral mitochondrial membrane protein, blocks apoptosis induced by a
wide array of death signals and is involved in decreasing ROS production (Jang and
Surh 2003). Bcl -2 protein itself has anti oxidant ability either by prevention of entrance
of cytochrome c to the cytosol or by binding directly with cytochrome c to reduce
generation of free radicals (Shimizu et al. 1995). Furthermore, Bcl -2-overexpressing
cells exhibit elevated levels of cellula r GSH (Amstad et al. 2001). On the other side,
involved in mediating mitochondrial membrane channels, Bax and Bak contribute to
the release of apoptogenic proteins, such as cytochrome c. By stimulating Bax
expression, p53 (main tumor suppressor protein) sk ews the Bax to Bcl -2 ratio and
promotes apoptosis (Hemann and Lowe 2006). Lycopene, a principal compound
naturally present in red colored foods such as tomatoes, watermelons, and papayas,
has many health benefits. It is a lipid soluble pigment containing c arbon skeleton of
about forty atoms with unsaturated straight hydrocarbon chain having eleven
conjugated and two non -conjugated carbon –carbon (C=C) unsaturated bonds
4

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official version of record. Page 5 of 31
(Shi and Le Maguer 2000). The symmetrical distribution of unsaturated bonds renders
lycopene approximately potent antioxidant (Shi and Le Maguer 2000). The antioxidant
property of such pigment is returned to its ability to quenc h singlet oxygen and capacity
to attack peroxide radicals (Kelkel et al. 2011). Lycopene has the highest ability to
quench singlet oxygen in compared with α -carotene, β -carotene, and lutein (Agarwal
and Rao 2000). The same authors added that, lycopene has been reported to be
associated with the decreased incidence of many important diseases by inhibition of
lipid peroxidation. Lycopene has a neuroprotective and anticancer activities (Kelkel et
al. 2011). Moreover, it has been demonstrated to decrease the in cidence of liver
cirrhosis by modulating the activity of hepatic stellate cells (Kitade et al. 2002). To our
information, the possible protective effects of this pigment against MSG -induced
neurotoxicity have never been reported. Furthermore, although many researchers have
reported many unwanted side effects of MSG, other groups claimed that it is safe to be
added to human foods even at high doses (Beyreuther et al. 2007). We therefore
investigated the influence of concomitant supplementation of MSG and lyc opene on
some makers of oxidative status and brain cell injury in rats. The effects on the level of
malondialdehyde (MDA), an indicator of lipid peroxidation, reduced glutathione (GSH)
and the activities and gene expression of some antioxidant enzymes and pro-
apoptotic/anti -apoptotic proteins. In addition, the effects on the enzyme markers of
neurocellular injury creatine phosphokinase (CPK), creatine phosphokinase brain
isoenzyme (CPK -BB), and lactate dehydrogenase (LDH) were also studied.
2. Material and methods
2.1. Chemicals
5

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 6 of 31
Monosodium glutamate (MSG), lycopene, reduced glutathione (GSH),
trichloroacetic acid (TCA), 5,5’ -dithiobis -[2-nitrobenzoic acid] (Ellman’s reagent),
thiobarbituric acid (TBA), 2,4 -dinitrophenyl hydrazine (DNPH),1 -chloro -2,4-
dinitrobenzene (CDNB), agarose, ethidium bromide, chloroform, and isopropanol
were obtained from (Sigma Chemical Co., St. Louis, MO, USA). TriZol reagent was
supplied by Invitrogen, Carlsbad, CA. QuantiFast SYBR Green PCR Master Mix kit
was supplied by QIAGEN, Hilden; Germany. The other reagents were of analytical,
high-performance liquid chromatography (HPLC), or the best available
pharmaceutical grade.
2.2. Preparation of MSG solution
MSG was dissolved in distilled water. This solution was injected according to the
weight of the rats so that each rat received 5 mg/kg b.w. MSG subcutaneously
(Hamaoka and Kusunoki, 1986). This dose schedule was much less than the lethal
dose of 30 mg/kg o f b.w. by the i.p. route (Walker and Lupien 2000). There was no
mortality in all groups.
2.3. Animals and treatment
The experiment was carried out on thirty -two male albino Wistar rats (130 -160 g wt
and 2 months age). The rats were kept in the well -ventila ted metal cages during the
study. The light cycle was 12 hr of darkness and 12 hr of daylight, and they had
supplemented with standard rat feed and tap water ad libitum . The rats received
humane care as in the guidelines of the National Institute of Health (NIH) for ethical
treatment and management of laboratory animals. After a period of 2 weeks
acclimatization, the animals were allotted into 4 experimental groups of 8 rats in each.
The rats in the placebo or vehicle -treated group gastrogavaged with (1 ml) corn oil and
were subcutaneously (s.c.) injected with (1 ml) distilled water for 4 weeks; the MSG –
treated group taken corn oil (1 ml) orally and injected s.c. with freshly prepared
6

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and p age composition. It may differ from the final official version of record. Page 7 of 31
MSG solution (5 mg/kg bwt/day) dissolved in 1 ml distilled water for 4 weeks; the
lycopene -treated group taken lycopene (10 mg/kg bwt/day) dissolved in 1 ml corn oil
by stomach tube and injected s.c. with (1 ml) distilled water for 4 weeks; the lycopene
+ MSG -treated group gastrogavaged with lycopene and injected s.c. with MSG (the
same dose and route of administration as previously mentioned). The dose of lycopene
used in the present study was reported to have a neuroprotective effect (Sandhir et al.
2010).
2.4 Blood sampling
The rats were weighed before the treatments were initiated and before they were
sacrificed, and the change in weight was noted. The rats were anesthetized on the 30th
day with a dose of Thiopentone Sodium ([50 mg/kg of b.w intraperitoneal]; Chatterjee,
1993). Blood samples obtained by cardiac puncture into a clean 2 ml test tube.
Following a period of 30 min at room temperature, the samples were centrifuged at
3400 x g for 10 min and the serum was separated, put into Eppendorf tubes, and stored
at -20 șC until determination of the biochemical parameters.
2.5. Collection of brain tissue
The brain tissue was excised and rinsed in ice -cold 1.15% KCl to remove blood and
other extraneous substances, dried on a filter paper and weighed. The brain was
subsequently homogenized in four parts of ice -cold buffer containing 50 mM Tris -HCl
and 1.15% KCl, pH 7.4. The homogenate was centrifuged at 1000 x g for 15 min at
4°C. The obtained supernatant was used for all of the analyses on the brain tissue.
Each sample was tested in triplicate.
2.6. Determination of the antioxidant Indices and the activity o f brain acetyl
cholinesterase
7

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 8 of 31
The obtained supernatant was used for the assessment of the levels of the followi ng
parameter. Lipid peroxidation (LPO), assessed as the production of the thiobarbituric
acid-reactive substances (TBARS) (Buege and Aust 1987); reduced glutathione,
determined by Ellman’s reagent (Sedlak and Lindsay 1968); glutathione S -transferase
(GST, EC 2.5.1.18) activity, determined as the rate of CDNB conjugation with GSH
(Habig et al. 1974); catalase (CAT, EC 1.11.1.6) activity, determined as the rate of
hydrolysis of hydrogen peroxide (Aebi 1974). The superoxide dismutase (SOD)
activity was assesse d as the brain fraction was reacted with an adrenaline solution and
the rate of inhibition of adenochrome formation from the auto -oxidation of adrenaline
was measured spectrophotometrically at 480 nm (Misra and Fridovich 1972).
Acetylcholinesterase (EC 3.1 .1.7) activity was assessed as the rate of the
acetylthiocholine hydrolysis (Ellman et al. 1961). The protein content was estimated
by spectrophotometer using the standard bovine serum albumin with Folin reagent.
2.7. Gene expression of brain Bcl2, Bax and antioxidant enzymes using real -time
PCR.
The brain tissue was used for extraction of the total RNAs using the TRIzol method
following the manufacturer’s protocol (Alshabanah et al. 2010). The amount and
purity of the RNA was assessed using UV spectrophotometer. The extracted RNA had
an A 260/280 ratio of >1.9. The initial cDNA synthesis step and subsequent real -time
PCR step performed following the standard methods (Alshabanah et al. 2010). We
used β -actin gene as a house keeping gene. The used primers were listed in Table 1.
2.8. Biochemical serum parameters
8

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 9 of 31
The activities of the serum ChE, CPK, CPK -BB and LDH were
spectrophotometrically determined using commercially available diagnostic kits
(Biodiagnostic Co., Egypt), following the manufacturer’s instructions.
2.9. Statistical Analysis
The data were presente d as Mean ± standard error of the mean (SEM). Statistical
difference between the means was calculated by ANOVA. The Duncan`s test was used
for post hoc multiple comparisons. The P< 0.05 value was considered as significant
level.
3. Results
3.1. The antioxi dant Indices and brain acetylcholinesterase activity
Relative to the placebo group, the MSG injection significantly (P < 0.05) increased the
level of MDA and the activities of GST, CAT and SOD in brain tissues. MSG
exposure was resulted in a significant de crease in GSH content (Table 2). The rats
gastrogavaged with lycopene and injected with MSG significantly (P < 0.05)
decreased the MDA concentrations (30%) and the activities of GST, CAT and SOD in
the examined tissue than those injected with MSG alone. Mo reover, the GSH levels in
the brain of the lycopene and MSG -co-administrated rats were greater than those of
the MSG -injected rats. Finally, as shown in Table 3, the brain AChE activity of the
MSG -injected rats was significantly increased (P < 0.05) than t hat of the control,
lycopene, and lycopene -MSG -co-administrated groups.
3.2. GST, CAT, Bcl2 and Bax gene expression
The effect of MSG on the expression levels of the antioxidant genes Catalase and
glutathione S -transferase in the brain was affirmed by q -RT PCR. Figure 1, 2, 3 show
9

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 10 of 31
the effect of MSG on the mRNA level of catala se, glutathione S -transferase, B -cell
lymphoma2 (Bcl2) and Bcl2 associated X (Bax) genes in the brain. The MSG -treated
rats showed a significant upregulation of Bax and antioxidant enzymes gene and
downregulation of Bcl2 gene. On the contrary, lycopene co -treatment showed
downregulation of the expression of antioxidant enzymes and Bax genes compared
with the control and MSG -treated groups while it upregulate Bcl2 gene. The changed
mRNA level of the tested genes obviously reveals that the modifications in th e
activities of catalase and GST are occurred at the gene transcription level.
3.3. Biochemical profile
In Comparison with the untreated control rats, the MSG -injected rats showed a
significant higher (P < 0.05) level of serum ChE, CPK, CPK -BB and LDH activity
(Table 3). While, the lycopene co -administrated MSG -challenged rats exhibited
significant decreases in all of the serum biochemical parameters that reflected brain
damage compared to the MSG -treated g roup.
3.4. Sodium and potassium level
The level of serum sodium in the MSG -treated rats was significantly higher and serum
potassium was less (P < 0.05) than those of the placebo rats. However, the observed
changes in the serum sodium and potassium concent rations were absent (P > 0.05)
with lycopene treatment (Table 4).
3.5. Body weight differences
The body weight difference of MSG -injected rats was increased significantly (P <
0.05) than of the control group. In contrast, the lycopene co -treated MSG -challe nged
rats significantly decreased the body weight in compared to the MSG -treated rats
(Table 4).
10

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 11 of 31
4. Discussion
MSG enhances the flavor in many processed foods and drinks (Alao et al. 2010).
Although, MSG was appeared firstly to be safe because it is a natural substance. But
recently, considerable attention has been focused on its unusual neurological effects
(Reis et al. 2009). The previous stud ies report several mechanisms underlie MSG
induced cellular degeneration. Initially, Olney (1969) reported that, MSG directing the
nerve tissues to death by rendering them to be continuously excited resulting in brain
damage. The excitotoxic effect of glut amate is mediated by its binding with N -methyl –
D-aspartate (NMDA) receptors. This interaction leads to an uncontrolled rise in the
intracellular calcium concentration, and this elevated intracellular calcium activates
various enzymes contributing to cell d eath by various mechanisms including
hippocampal neuronal death (Narayanan et al. 2010; Rivera -Cervantes et al. 2015).
Also, Kainic acid receptor (KA -R) subunits that differentially expressed during brain
development, and they modulate both neural growth a nd survival, (Beas -Zárate et al.
2008) reported that high concentrations of glutamate in the brain can induce neuronal
injury through altering the expression of these receptors. Ortuño -Sahagún et al. (2012)
conducted a microarray analysis on the hippocampu s gene expression profiles under
MSG -induced excitotoxicity conditions and they reported an increased gene
expression that mainly related to excitotoxicity (CaMKII, glypican 2, GFAP, NCX3,
IL-2, and Gmeb2) or to cell damage response (dynactin and Ecel1). M oreover, the
excitotoxicity triggered by neonatal MSG treatment produces a significant
pathophysiological impact on adulthood, which could be due to modifications in the
blood -brain barrier (BBB) permeability (Gudiño -Cabrera et al. 2014). Furthermore,
Chap arro-Huerta et al. (2008) indicated that, neuronal death induced by excitotoxicity
11

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 12 of 31
MSG appears to be mediated through p38 MAPK s ignaling pathway activated by pro –
inflammatory cytokines TNF -alpha. In addition, Leira and Rodríguez (1995) described
that, MSG can interference with acetylcholine synthesis.
In this experiment, we examined the potential neurotoxicity induced by MSG
and the modulatory effect of lycopene, a nutritional antioxidant, on MSG -induced
neurotoxicity was also studied.
MSG administration significantly induced lipid peroxidation (LPO) an d
decreased the GSH level in the brain tissue (Table 2). Previously, induction of LPO
and a decrease in the GSH level were reported following exposure to MSG (Singh et
al. 2003). On the other side, glutathione not only act as a radical scavenger but also
stabilize membrane structure through the removal of the acyl peroxides formed by
lipid peroxidation. Thus, MSG -induced LPO attributed to the tissue depletion of GSH
and this depletion reflects the inability of primary antioxidant system to counteracting
the production free radicals (Huang et al. 2004). The same authors revealed that, the
concurrent increase in MDA with decrease in GSH levels will associated with
generation of ROS, and subsequently induced lipid peroxidation.
MSG administration significantly increased GST activities in the brain tissue
(Table 2). GSTs possess a unique activity counteracting oxidative stress, with GSTA
exhibiting a potent glutathione peroxidase -like activity towards organic peroxides
resulting from LPO. The increase in the GST activity in MSG -treated rats was
correlated with the decrease in GSH level in which GSH is a substrate for GST and
therefore, should decrease with increased GST activity. GST is required for decreasing
the oxidative stress through the detoxification of ROS , thus the generation
12

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 13 of 31
of ROS and lipid peroxides following MSG administration could have contributed to
the increased GST activity and subsequent decrease in GSH levels.
The administration of MSG significantly increased brain SOD and catalase
activities (table 2). SOD decrease the incidence of oxidative stress by converting O 2•−
to H2O2, a more stable ROS, while Catalase catalyzes the conversion of the superoxide
radical into hydrogen peroxide radical and finally converts hydrogen peroxide to
water, supporting protection against free radicals by this action (Sayed -Ahmed et al.
2010). The increment in the act ivities of SOD and catalase in this study could be a
way to compensate the depletion in GSH levels. Moreover, the increased enzyme
synthesis by induction on administration of MSG could also be attributed to the
increased activities of SOD and catalase in w hich the antioxidant enzymes are
responded to oxidative stress by increasing its synthesis through induction (Limaye et
al. 2003).
Our results confirmed that the MSG -induced oxidative stress resulted in the
upregulation of CAT and GST gene expression to co unteract the increased ROS and to
compensate the decrease in other antioxidants especially, MSG -GSH complexes could
have led to an increase in oxidative stress by decreasing GSH storage. The increment
in the activity of GST and the upregulation of its expr ession with increased oxidative
stress and apoptosis in breast cancer confirm this theory (Huang et al. 2004). Notably,
when co -administered with MSG, lycopene significantly decreased the LPO levels and
significantly increasing the level of GSH in the brai n of rats. Lycopene strongly
inhibits the induction of oxidative stress by chain -breaking, trapping free radicals and
to lesser extend by interacting with ROS or chelating metal ions (Kelkel et al. 2011;
Lebda et al. 2012). Similarly, the impacts of lycope ne on
13

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 14 of 31
reduced glutathione might be returned to inhibition of glutathione oxidation (Kaur et al.
2011). Also, virtues of conjugated double bonds high percent of lycopene that help in
quenching free radical anions render it a potent free radical scavenger (Kelkel et al.
2011), by this function the activities and expression of antioxidant enzymes decreases.
Interestingly, lycopene when co -administered with MSG significantly decreased
GST, SOD and catalase activities and downregulating CAT and GST gene expression,
thereby ameliorating the oxidative stress induced by MSG in the brain tissue. The
significant decreases in the GST activity must have been affected through the
lycopene -mediated scavenging of the organic peroxides. The activity of SOD and
catalase significan tly decreased and reduced glutathione increased upon administration
of lycopene with MSG and this could be attributed to the ability the antioxidants to
compensate each other (Limaye et al. 2003). Similarly, providing the antioxidants
vitamins were avertin g the adverse effects of MSG -induced oxidative stress in
different organs (Onyema et al. 2006; Tawfik and Al -Badr 2012).
It well known that, the oxidative stress caused cell death via apoptosis. Bcl -2 is
an integral mitochondrial membrane protein and acts as anti apoptotic and antioxidant
factor (Jang and Surh 2003). Bcl -2 reduced the generation of ROS through binding to
cytochrome c or prevents its entry to the cytosol (Shimizu et al. 1995). The increase in
the expression of Bcl -2 exhibit elevated levels o f cellular GSH (Amstad et al. 2001).
On the contrary, involved in mediating mitochondrial membrane channels, Bax and
Bak contribute to the release of apoptogenic proteins, such as cytochrome c. By
stimulating Bax expression, p53 (main tumor suppressor prot ein) skews the Bax to Bcl –
2 ratio and promotes apoptosis (Hemann and Lowe 2006). The present results revealed
that, MSG upregulate the pro -apoptotic Bax and downregulate the anti –
14

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and p age composition. It may differ from the final official version of record. Page 15 of 31
apoptotic Bcl2. This result gives evidence that, MSG caused neurotoxicity by
induction of apoptosis in the brain tissue. However, the expression of Bax gene was
decreased and Bcl -2 gene expression was increased upon co -administration of
lycopene with MSG. The significant up regulation of Bcl2 gene expression and down
regulation Bax gene expression in MSG -intoxicated rats treated with lycopene
compare to MSG untreated rats was to maint ain the anti -apoptotic and antioxidant
effect of Bcl2 in rat's brain. This result give an evidence that lycopene explain its
neuroprotective effect in a part due to increased expression of Bcl -2 gene and
decreased expression of Bax gene in MSG induced neur otoxicity. Unfortunately, we
did not find data concerning the effect of lycopene on MSG induced apoptosis to
discuss them with our results. These results concerning the ability of lycopene to
ameliorate the apoptotic effects of MSG on brain tissues are pro mising and novel.
The activities of serum ChE, CPK and LDH in the MSG -injected rats were
increased. The increased serum activities of ChE, CPK and LDH in the MSG -injected
rats reflect the brain damage. These increases could be explained by reactions of the
free radicals with cell membranes polynoids, causing cell injury and subsequently
enzyme leakage. The result appears to be consistent with the reports of Onyema et al.
(2006), who reporting the increased activity of serum enzymes in male rats that were
fed MSG and attributed these increments to oxidative stress. MSG also easily
dissociates giving free glutamate, which liberate ammonia that could be harmful to the
brain tissue unless eliminated in the liver via the formation of urea (Tawfik and Al –
Badr 2012 ). Hence, the ammonium ion overproduction resulting from exposure to
MSG could injury the brain, consequently releasing the CPK, LDH and ChE enzymes
that may lead to the observed elevation in the levels of these enzymes.
15

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and p age composition. It may differ from the final official version of record. Page 16 of 31
The activities of serum ChE, CPK and LDH in the MSG -injected rats were
decreased upon administration of lycopene. The decreased activities of these enzymes
upon administration of lycopene in the present study returned to its antioxidant
properties and subs equently protect cell membrane from oxidative stress induced
injuries (Shi and Le Maguer 2000).
The activity of brain AChE in MSG -injected rats increased significantly in
compared to control group and decreased significantly in lycopene + MSG -treated
rats. Firstly, as a marker of cholinergic dysfunction, AChE activity frequently
associated with increased ROS. On the other hand, acetylcholine able to scavenging
superoxide anions and so plays a neuroprotective role by reducing the ROS levels
(Milatovic et al. 2006). Furthermore, MSG was found to be interferes with
acetylcholine synthesis (Leira and Rodríguez 1995). The serum and brains ChE
activities of MSG -treated group in the present experiment were increased by 1.5 -fold
and 1.8 -fold, respectively than of th e controls (Table 3), thus a decrease in the
acetylcholine levels may also result from increased AChE activity. On the contrary,
co-treatment with lycopene was succeeded to maintain ChE activity within the
reference level. Therefore, the present study conc ludes that lycopene might be
improved the cholinergic dysfunction induced by MSG either by decreasing AChE
activity (Kuhad et al. 2008) or by inhibiting ROS (Kaur et al. 2011).
MSG increased body weight and lycopene decreased it. Firstly, MSG intake
might increase the calories intake and subsequently lead to obesity (Bergen et al. 1998;
Diniz et al. 2004). In addition, MSG might be induced overweight by increasing the
palatability to food and perturbation in hypothalamic signaling cascade involving leptin
hormone (He et al. 2011). The same authors showed that, exposure of rats and
16

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 17 of 31
mice to MSG results in the hypothalamic injur y. On the other side, the control of
weight in the MSG + lycopene -injected rats reflected the possible role of lycopene in
managing body weight (Walker and Lupien 2000). To the best of our knowledge, the
exact mechanism(s) of lycopene in managing body weig ht not well known but it might
attributed to prevent the perturbation in hypothalamic signaling cascade involving
leptin hormone induced by MSG and subsequently decreased feed intake and increased
energy expenditure.
When given to rats, MSG resulted in dis turbances in sodium and potassium
balance, with sodium being increased and potassium being decreased. This disturbance
might have resulted from the nephrotoxic effect of MSG (Abass and Abd El -Haleem
2011). The same authors revealed that, MSG induced nephro toxicity reflected in
increases in urinay creatinine and albumin. However, in their study, no significant
differences were reported in the level of electrolytes of the MSG -intoxicated rats in
compared to controls. Their result indicates that normal renal c apacity to excrete the
electrolytes was maintained, possibly reflecting some degree of preservation of the
renal integrity. On the other hand, lycopene co -administration with MSG failed to
correct the imbalance in sodium and potassium levels.
5. Conclusion
MSG has many unwanted effects when it is added to food and its use as a flavor
enhancer should be minimized or prevented. The neurotoxicity of MSG might result
from cholinergic dysfunction, increased LPO and induction of oxidative stress and
subsequent ap optosis. Interestingly, co -treatment of lycopene to MSG -intoxicated rats
appears to be efficient in ameliorating the hazard effects of MSG by inhibiting
oxidative stress and inducing modifications in the acetylcholinesterase activity and
17

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 18 of 31
antioxidant homeostasis. Surprisingly, lycopene protect brain tissue by inhibitin g
apoptosis signaling induced by MSG.
Acknowledgement
We are grateful for the assistance of the Faculty of Veterinary Medicine, Damanhur
University. The authors acknowledge the scholars who published the articles included
in the reference section of this manuscript.
Declaration of interest
The authors declare no any conflicts of interest.
References
Abass, M.A., Abd El -Haleem, M.R. 2011. Evaluation of Monosodium Glutamate
Induced Neurotoxicity and Nephrotoxicity in Adult Male Albino Rats. J. American
Sci. 7(8): 264 -276.
Aebi, H. 1974. Catalase in methods of en zymatic analysis. Edited by H.U. Bergmager.
Chemie, Weinheim, FRG, pp. 673 –84.
Agarwal, S., and Rao, A.V. 2000. Tomato lycopene and its role in human health and
chronic diseases. CMAJ. 163: 739 –44.
Alao, O.A., Ashaolu, J.O., Ghazal, O.K., Ukwenya, V.O. 2010. Histological and
biochemical effects of monosodium glutamate on the frontal lobe of adult Wistar rats.
Int. J. Biomed. Health Sci. 6(4): 197 -203.
18

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and p age composition. It may differ from the final official version of record. Page 19 of 31
Alshabanah, O.A., Hafez, M.M., Al -Harbi, M.M. 2010. “Doxorubicin toxicity can be
ameliorated during antioxidant Lcarnitine supplementation,” Oxidative Med. Cell
Longevity, 3 (6): 428 –433.
Amstad, P.A., Liu, H., Ichimiya, M., Berezesky, I.K., Trump, B.F., Buhimschi, I.A., et
al. 2001. BCL -2 is involved in preventing oxidant -induced cell death and in
decreasing oxygen radical production. Redox Rep. 6: 351 –362.
Beas -Zárate, C., Ureña -Guerrero, M.E., Flores -Soto, M., Armendariz -Borunda, J.,
Ortuño -Sahagún, D. 2007. The expression and binding of kainate receptors is
modified in different brain regions by glutamate neurotoxicity during postnatal
ratdevelopment. Int. J. Dev. Neurosci. 25(1): 53 -61.
Bergen, H.T., Mizuno, T.M., Taylor, J. 1998. “Hyperphagia and Weight Gain after
Gold -Thioglucose and Monoso – dium Glutamate: Relation to Hypothalamic
Neuropeptide,” Endocrinology, 139(11): 4483 -4488.
Beyreuther, K., Biesals ki, H.K., Fernstrom, J.D., Grimm, P., Hammes, W.P.,
Heinemann, U., et al. 2007. Consensus meeting: monosodium glutamate – an update.
Eur. J. Clin. Nutr. 61: 304 -313.
Branen, A.L. 2002. Food Additives, 2nd edition. New York: Marcel Dekker.
Buege, J.A., Aust, S.D. 1987. Microsomal lipid peroxidation. In Methods in
enzymology. Edited by S. Fleischer and L. Packer. Academic Press, pp. 302 –310.
19

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official version of record. Page 20 of 31
Chaparro -Huerta, V., Flores -Soto, M.E., Gudiño -Cabrera, G., Rivera -Cervantes, M.C.,
Bitzer -Quintero, O.K., Beas -Zárate, C. 2008. Role of p38 MAPK and pro –
inflammatory cytokines expression in glutamate -induced neuronal death of n eonatal
rats. Int. J. Dev. Neurosci. 26(5): 487 -95.
Chatterjee, T.K. 1993. Handbook of Laboratory mice and rats. Edited by K.
Chatterjee, Calcutta, 3 -8.
Dalton, L. 2012. "Food Preservatives". Chemical and Engineering News, 80 (45), 40 –
47.
Diniz, Y.S., Fernando, A.A., Campos, K.E., Mani, F., Ribas, B.D., Novelli, E.L. 2004.
“Toxicity of Hyper Caloric Diet and Monosodium Glutamate: Oxidative Stress and
Metabolic Shifting in Hepatic Tissue,” Food Chem. Toxicol. 42: 319 -325.
El-Baher, M. 2013. Biochemistry of free radicals and oxidative stress. Science
International, 1: 111 –117.
Ellman, G.L., Courtney, K.D., Andres, V., Feather -Stone, R.M. 1961. A new and rapid
colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7:
88–95.
Eweka, A.O., Adjene, J.O. 2007. Histological studies of the effects of monosodium
Glutamate on the medial geniculate body of adult Wister rat. Electron J. Biomed. 22:
9-13.
20

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and p age composition. It may differ from the final official version of record. Page 21 of 31
Fernstrom, J.D. 2000. Second International Conference on Glutamate: Conference
summary. J. Nutr. 130: 1077 -1079.
Gudiño -Cabrera, G., Ureña -Guerrero, M.E., Rivera -Cervantes, M.C., Fer ia-Velasco,
A.I., Beas -Zárate, C. 2014. Excitotoxicity triggered by neonatal monosodium
glutamate treatment and blood -brain barrier function. Arch. Med. Res. 45(8): 653 –
659.
Habig, W.H., Pabst, M.J., Jakoby, W.B. 1974. Glutathione S -transferases. The first
enzymatic step in mercapturic acid formation. J. Biol. Chem. 249: 7130 –9.
Hamaoka, K., and Kusunoki, T. 1986. Morphological and cell proliferative study on
the growth of visceral organs in monosodium Lglutamate –treated obese mice. J. Nutr.
Sci. Vitaminol. 32 : 395 -411.
He, K., Du, S., Xun, P., Sharma, S., Wang, H., Zhai, F., et al. 2011. “Consumption of
Monosodium Glutamate in Relation to Incidence of Overweight in Chinese Adults:
China Health and Nutrition Survey (CHNS),” Am. J. Clin. Nutr. 93(6): 1328 -1336.
Hemann, M.T., Lowe, S.W. 2006. The p53 -Bcl-2 connection. Cell Death Di ffer. 13:
1256 -1259.
Huang, J., Tan, P.H., Tan, B.K., Bay, B.H. 2004. “GST -pi expression correlates with
oxidative stress and apoptosis in breast cancer,” Oncology Reports, 12(4): 921 –925.
Jang, J.H., Surh, Y.J. 2003. Potentiation of cellular antioxidant c apacity by Bcl -2:
implications for its antiapoptotic function. Biochem. Pharmacol. 66: 1371 –1379.
21

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 22 of 31
Kaur, H., Chauhan, S., Sandhir, R. 2011. Prot ective effect of lycopene on oxidative
stress and cognitive decline in rotenone induced model of Parkinson’s disease.
Neurochem. Res. 36: 1435 –43.
Kelkel, M., Schumacher, M., Dicato, M., Diederich, M. 2011. Antioxidant and anti –
proliferative properties of lycopene. Free Radic. Res. 45: 925 –940.
Kitade, Y., Watanabe, S., Masaki, T., Nishioka, M., Nishino, H. 2002. Inhibition of
liver fibrosis in LEC rats by a carotenoid, lycopene, or a herbal medicine, Sho -saiko –
to. Hepatol. Res. 22: 196 –205.
Kuhad, A., Sethi, R., Chopra, K. 2008. Lycopene attenua tes diabetes -associated
cognitive decline in rats. Life Sci. 83:128 –134.
Lebda, M.A., El -Neweshy, M.S., El -Sayed, Y.S. 2012. Neurohepatic toxicity of
subacute manganese chloride exposure and potential chemoprotective effects of
lycopene. NeuroToxicology, 33: 98–104.
Leira, R., Rodrı´guez, R. 1995. Dieta y migran˜ a. Revista de Neurologı´a, 24: 534 –
538.
Limaye, P.V, Raghuram, N., Sivakami, S. 2003. Oxidative stress and gene expression
of antioxidant enzymes in the renal cortex of streptozotocin -induced diab etic rats.
Mol. Cell Biochem. 243: 147 -152.
MatEs, J.M., Pérez -Gmez, C., DeCastro, I.N. 1999. Antioxidant enzymes and human
diseases. Clin. Biochem. 32: 595 –603.
22

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 23 of 31
Milatovic, D., Gupta, R.C., Aschner, M. 2006. Anticholinesterase toxicity and
oxidative stress. Sci. World J. 6: 295 –310.
Misra, H.P., and Fridovich, I. 1972. The role of superoxide anion in the autoxidation
of epinephrine and a simple assay for superoxide dismutase. J. Biol. Chem. 247: 3170 –
3175.
Moore, K.L. 2003. Congenital malformat ions due to environmental factors;
Developing Humans W.B. Saunders Co. Ltd Philadelphia 2nd Ed. Chap 8. pp. 173 –
183.
Narayanan, S.N., Kumar, R.S., Paval, J., Nayak, S. 2010. Effect of ascorbic acid on
the monosodium glutamate -induced neurobehavioral changes in periadolescent rats.
Bratisl. Lek. Listy. 111 (5): 247 -252.
Olney, J.W. 1969. Brain lesions, obesity and other d isturbances in mice treated with
monosodium glutamate. Science, 164: 719 -721.
Onyema, O.O., Farombi, E.O., Emerole, G.O., Ukoha, A.I., Onyeze, G.O. 2006.
“Effect of Vitamin E on Mono – sodium Glutamate Induced Hepatoxicity and
Oxidative Stress in Rats,” Ind ian J. Biochem. Biophysics, 43 (1): 20 -24.
Ortuño -Sahagún, D., Rivera -Cervantes, M.C., Gudiño -Cabrera, G., Junyent, F.,
Verdaguer, E., Auladell, C., et al. 2012. Microarray analysis of rat hippocampus
exposed to excitotoxicity: reversal Na(+)/Ca(2+) exchan ger NCX3 is overexpressed in
glial cells. Hippocampus, 22(2): 128 -140.
23

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 24 of 31
Pavlovic, V., Pavlovic, D., Kocic, D., Sokolovic, D., Jevtovic -Stoimenov, J. 2007.
Effect of monosodium glutamate on oxidative stress and apoptosis in rat thymus. Mol.
Cell Biochem. 303:161:166.
Reis, H.J., Guatimosim, C., Paquet, M., Santos, M., Ribeiro, F.M., Kummer, A., et al.
2009. Neuro -transmitters in the central nervous system & their implication in learning
and memory processes. Curr. Med. Chem. 16: 796 -840.
Rivera -Cervantes, M.C., Castañe da-Arellano, R., Castro -Torres, R.D., Gudiño –
Cabrera, G., Feria, Y., Velasco, A.I., et al. 2015. P38 MAPK inhibition protects
against glutamate neurotoxicity and modifies NMDA and AMPA receptor subunit
expression. J. Mol. Neurosci. 55(3): 596 -608.
Sandhir, R., Mehrotra, A., Kamboj, S.S. 2010. Lycopene prevents 3 -nitropropionic
acid-induced mitochondrial oxidative stress and dysfunctions in nervous system.
Neurochem. Int. 57: 579 –587.
Sayed -Ahmed, M.M., Aleisa, A.M., Al -Rejaie, S.S. 2010. “Thymoquinone atten uates
diethylnitrosamine induction of hepatic carcinogenesis through antioxidant signaling,”
Oxidative Med Cell Longevity, 3(4): 254 –261.
Sedlak, J., and Lindsay, R.H. 1968. Estimation of total, protein -bound, and nonprotein
sulfhydryl groups in tissue with Ellman’s reagent. Anal. Biochem. 25:192–205.
Shi, J., Le Maguer, M. 2000. Lycopene in tomatoes: chemical and physical properties
affecte d by food processing. Crit. Rev. Food Sci. Nutr. 40: 1–42.
24

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 25 of 31
Shimizu, S., Eguchi, Y., Kosaka, H., Kamiike, W., Matsuda, H., Tsujimoto, Y. 1995 .
Prevention of hypoxia -induced cell death by Bcl -2 and Bcl -xL. Nature, 374: 811 –813.
Singh, P., Mann, K.A., Mangat, H.K., Kaur, G. 2003. Prolonged glutamate
excitotoxicity: effects on mitochondrial antioxidants and antioxidant enzymes. Mol.
Cell Biochem. 243: 139 -145
Tawfik, M.S., and Al -Badr, N. 2012. Adverse Effects of Monosodium Glutamate on
Liver and Kidney Functions in Adult Rats and Potential Protective Effect of Vitamins
C and E. Food and Nutrition Sci. 3: 651 -659.
Walker, R., and Lupien, J.R. 2000. “The Safety Evaluation of Monosodium
Glutamate,” J. Nutr. 130 (4): 1049 -1052.
25

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 26 of 31
Table 1 . The sequences of the primers used
Primer Forward Reverse
CAT AGG TGA CAC TAT AGA ATA GTG GTT GTA CGA CTC ACT ATA GGG ACA
GST GCC TTC TAC CCG AAG ACA CCT T GTC AGC CTG TTC CCT ACA
Bcl2 GACTTCGCCGAGATGTCCAG GTGCAGGTGCCGGTTCAGG
Bax AGGTCTTTTTCCGAGTGGCAGC CCGGAGGAAGTCCAATGTCC
β-actin GGACCTGACAGACTACC GGCATAGAGGTCTTTACGG
Table 2: Effects of MSG and co -treatment with lycopene on lipid peroxidation
and the levels of antioxidants in the brain in rats .
Group Catalase
activity
(Units/mg
protein) SOD activity
(Units/mg
protein) Glutathione -s-
transferase
activity
(Units/mg
protein) GSH
(mmol/mg
protein) Lipid
peroxidation
(nmol/g wet
tissue)
Control 7.46±1.03b 11.08±0.61b 96.17±7.28b 79.54 ±2.05a 91.45 ±4.57c
MSG 9.23±1.19a 19.52±1.26a 124.54±8.64a 41.90 ± 2.36c 183.45 ± 3.29a
lycopene 3.98±0.13c 12.20±0.79b 79.73 ±6.63c 81.64 ±5.66a 69.64 ±3.56d
MSG+ lycopene 4.13±0.18c 11.38 ±1.59b 31.45 ±4.68d 61.33 ±0.93b 127.81 ± 4.58b

Means within the same column carrying different letters are significantly different
(P<0.05).
26

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 27 of 31
Table 3: Effects of M SG and co -treatment with lycopene on serum AChE, brain
AChE, serum CPK, CPK -BB and LDH in rats .
Group Serum ChE
(U/l) Brain AChE
(U/mg protein) CPK (U/l) CPK -BB (U/l) LDH (U/l)
Control 123.26±8.90b 1.47 ±0.06b 816.25±26.79b 307.84±19.05b 698.96±29.90b
MSG 187.54 ±9.53a 2.67 ±0.05a 1159.68±43.56a 521.24±38.94a 1568.95±51.23a
lycopene 91.27±7.49c 1.39 ±0.06b 567.34±34.53c 303.45±22.17b 683.45±35.68b
MSG+ lycopene 117.61 ±8.94b 1.42 ±0.04b 881.73±27.89b 313.35±18.90b 787.83±38.52b

Means within the same column carrying different letters are significantly different
(P<0.05).
27

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 28 of 31
Table 4: Effects of MSG and co -treatment with lycopene on body weight, blood
sodium and potassium levels in rats .
Group Initial Body
Weight
(g) Final Body
Weight (g) Body Weight
differences (g) Blood sodium
(mEq/L) Blood
potassium
(mEq/L)
Control 135± 2.1 146± 4.3 11±1.6c 123.13±4.56b 3.91±0.12a
MSG 153± 4.5 177± 5.1 24±2.5a 149.75±5.67a 1.67±0.08b
lycopene 150± 5.7 158± 3.9 8±1.1d 121.34±3.46b 4.17±0.19a
MSG+ lycopene 145± 3.9 159± 3.3 14±1.3b 147.18±3.58a 1.79±0.11b

Means within the same column carrying different letters are significantly different
(P<0.05).
28

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record. Page 29 of 31
Figure 1: Effect of M SG and lycopene on relative band density of rats brain CAT and GST
compared to β -actin
Figure 2: The effect of MSG and lycopene on gene expression level of antioxidant enzymes,
CAT and GST in rats brain tissue
Figure 3: The effect of MSG and lycopene on ge ne expression level of Bcl2 and Bax in rats brain
tissue
29

Control MSG Lycopene MSG+Lycopene

Can. J. Physiol. Pharmacol. Downloaded from www.nrcresearchpress.com by University of Otago on 11/24/15 For personal use only. This Just -IN manuscript is the accepted manuscript prior to copy editing and page composition. It may differ from the final official ve rsion of record.
Β-Actin
CAT
GST
Page 30 of 31

Control MSG Lycopene MSG+Lycopene

Control MSG Lycopene MSG+Lycopene

Figure 1: Effect of MSG and lycopene on relative band density of rats brain CAT and
GST compared to β -actin

1

2