Multiple mechanisms of cell death induced by chelidonine in MCF-7 [620642]

Multiple mechanisms of cell death induced by chelidonine in MCF-7
breast cancer cell line
Sakineh Kazemi Noureini⇑, Hosein Esmaili
Dept. Biology, Faculty of Basic Sciences, Hakim Sabzevari University, P.O. Box: 397, Sabzevar, Iran
article info
Article history:
Received 28 April 2014
Received in revised form 9 September 2014
Accepted 12 September 2014Available online 30 September 2014
Keywords:ChelidonineApoptosisAutophagySenescenceTelomeraseabstract
In a preliminary study screening anti-proliferative natural alkaloids, a very potent benzophenanthridine,
chelidonine showed strong cytotoxicity in cancer cells. While several modes of death have been identi-fied, most of anti-cancer attempts have focused on stimulation of cells to undergo apoptosis. Chelidonine
seems to trigger multiple mechanisms in MCF-7 breast cancer cells. It induces both apoptosis and
autophagy modes of cell death in a dose dependent manner. Alteration of expression levels of bax/bcl2, and dapk1a by increasing concentration of chelidonine approves switching the death mode from
apoptosis induced by very low to autophagy by high concentrations of this compound. On the other hand,
submicromolar concentrations of chelidonine strongly suppressed telomerase at both enzyme activityand hTERT transcriptional level. Long exposure of the cells to 50 nanomolar concentration of chelidonine
considerably accelerated senescence. Altogether, chelidonine may provide a promising chemistry from
nature to treat cancer.
/C2112014 Elsevier Ireland Ltd. All rights reserved.
1. Introduction
Chelidonium majus L., belonging to Papaveraceae family is one of
the most important medicinal plants with known anticancer prop-
erties. Soon after 1896 when Botkin reported two cases of carci-
noma, which responded to treatment with C. majus extracts,
clinical uses of its derivatives started by treatment of several
malignancies including gastric and breast cancer [1,2] . This plant
contains several chemically and pharmacologically interesting
alkaloids, that the most biologically active components are essen-
tially isoquinolines [3]. Among them benzophenanthridines have
been shown to block proliferation in several transformed and
malignant cell types with different cytotoxic mechanisms [4–7] ,
also in malignant melanoma cell regardless of their p53 status
[8]. A number of these interesting compounds have shown a
various strength of apoptogenic without DNA damage such aschelidonine [9], while some other including sanguinarine and chel-
erythrine stimulate a dose dependent DNA damage and cytotoxic-
ity[10]. Chelidonine has no significant cytotoxicity or DNA damage
in both normal mouse primary spleen cells types and mouse lym-
phocytic leukemic cells, L1210 cells, but completely arrested
growth of the latter [11]. The plant has shown selectively growth
inhibition in cancer cells while no significant toxicity in normal
cells even at about 50–100 fold concentrations [12]. There are also
reports on its synthetic derivative, Ukrain, showing radioprotective
effects on normal but not cancer cells [13]. In spite of very similar
structures, in cell culture models certain metabolites of this plant
showed much stronger effects than other, and cellular and molec-
ular mechanism(s) of each compound remained to elucidate. This
study has focused on antiproliferative mechanisms of chelidonine,
the major benzophenanthridine alkaloid of C. majus in cell culture
model.
http://dx.doi.org/10.1016/j.cbi.2014.09.013
0009-2797/ /C2112014 Elsevier Ireland Ltd. All rights reserved.⇑Corresponding author. Tel.: +98 571 4401 3012; fax: +98 571 4401 3365.
E-mail address: kazemibio@gmail.com (S.K. Noureini).Chemico-Biological Interactions 223 (2014) 141–149
Contents lists available at ScienceDirect
Chemico-Biological Interactions
journal homepage: www.elsevier.c om/locate/chembioint

The uncontrolled growth of most of cancer cells is mainly
because of the activity and expression of telomerase, the basically
reverse transcriptase key enzyme in cell immortality, which com-
pensates telomere attrition of an average of 100 ± 50 base-pairs
that occurs in proliferating normal cells [14] as a result of end rep-
lication problem. This enzyme is diminished and hardly detectable
in many adult somatic cells. However it is drastically over
expressed in 85–90% of different kind of human cancer cells by
up to a hundred-fold over the normal counterpart cells [15], and
therefore confers a strong selective advantage for continued
growth of malignant cells, in spite of their extremely short telo-
mere length [16,17] . Telomerase inhibition induces proliferative
senescence, apoptosis and genomic instability [18]. This ribonu-
cleoprotein has shown very complicated levels of gene/protein reg-
ulation [19], so various strategies can be employed to repress it at
least as a part of anti-cancer therapeutic strategies [20–22] .
This compound has shown interesting beneficial effects in anti-
cancer drug design. However, some investigators have focused on
reducing its side effects and enhancing effectiveness and bioavail-
ability through nano-particles. In a recent report Paul et al. have
introduced chelidonine-loaded PLGA nanoparticles that showed a
reasonable bioavailability in mice model while cytotoxicity is com-
parable with free chelidonine in hepatocarcinoma HepG2 cells
[23]. Our previous screening study has introduced chelidonine to
suppress telomerase strongly in hepatocarcinoma cell line, HepG-
2[7]. Here we show an almost complete suppression of telomerase
in MCF-7 that occurs even at very low concentrations of chelido-
nine. Moreover, it induced multiple modes of death; senescence,
apoptosis and autophagy. This may infer a global alteration in cell
control by chelidonine that make it more attractive to elucidate
detailed mechanisms of action, which needs more attention.
2. Material and methods
2.1. Cytotoxicity
Human breast adenocarcinoma cell line MCF7 (ACC115 from
DSMZ) were maintained in 75 cm2culture flasks in DMEM, supple-
mented with 10% heat-inactivated fetal bovine serum, 100 U/ml pen-
icillin, and 100 lg/ml streptomycin (all the materials from PAA,
Austria). Cells were grown in 5% CO2 and 95% air atmosphere at
37/C176C. Mediawerechanged every other day,andthe cellswere subcul-
tured every 5 days using trypsin-EDTA. Cell viability was evaluated
routinely by trypan blue exclusion method using hemocytometer.
To estimate the cytotoxicity of chelidonine, MTT test was
assessed [24]. Briefly exponentially growing cells were seeded in
96 well plates 10,000 cell per well and after 24 h incubated in med-ium containing various concentrations of chelidonine freshly pre-
pared from a stock solution (50 mM in absolute ethanol), while
the final concentration of ethanol was always less than 0.01%. After
48 h incubation MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-
tetrazolium bromide (Sigma-Aldrich) was added to final concen-
tration of 0.5 mg/ml to each well. Four hours further incubation
was done for MTT reduction to formazan purple product through
mitochondrial dehydrogenases of viable cells and after dissolving
it in dimethylsulfoxide including 10% SDS and 1% acetic acid, the
absorbance was measured at 570 nm using a plate reader (BioTek,
USA). The tests were repeated four times each in triplicate and the
50% lethal dosage, LD
50, values were calculated from dose–
response curves using Gen5 version1.06 software.
To study telomerase activity and gene expression levels in
chelidonine treated cells, subconfluent cultures were treated at
three different concentrations; a relatively low concentration cor-
related with low cytotoxicity of chelidonine in MTT test, a second
concentration was equal to IC 50to have the maximum possibletreatment and still producing enough cells for analysis, and a third
concentration represented around the midpoint of the cytotoxicity
curve. Treatment duration time was set to 48 h to have adequate
time for cycling cells, because telomerase is a very rare protein
in cells and is active only in a short period during S phase.
2.2. Telomerase activity
Subconfluent MCF-7 cells were seeded in 6 well plates and after
48 h incubation with various concentrations of chelidonine,
washed with PBS.
Cells were lysed in a buffer containing 10 mM Tris–HCl pH = 7.5,
1 mM MgCl 2, 1 mM EGTA, 0.1 mM Phenylmethylsulfonylfluoride
(PMSF), 5 mM beta-mercaptoethanol, 0.5% CHAPS and 10% glycerol
according to Kim et al. [25], and after 30 min incubation on ice the
lysates were centrifuged at 16,000 /C2gat 4/C176C for 30 min. The super-
natants were collected and stored at /C080/C176C until use. Protein con-
centration of supernatant was measured based on Bradford method
[26] using plate reader (BioTek, USA) and analyzed with Gene5 soft-
ware version1.06. For each of control and/or treated cells 0.5 lgo f
extracted total protein was used for quantitative TRAP assay based
on a real-time SYBR-Green method [27] with small modifications
[28]. The reaction mixtures including 1X SYBR Green master mix
(GenetBio, South Korea), 0.5 lg protein of cell extract, 10 pmol TS
(50-AATCCGTCGAGCAGATT-30) and 5 pmol ACX (50-GCGCGGCT
TACCCTTACCCTTACCCTAACC-30) primers were incubated 30 min
at 25 /C176C to allow the telomerase in the protein extracts to elongate
the TS primer by adding TTAGGG repeat sequences. Then the ampli-
fication of telomerase products was started at 94 /C176C for 10 min to
activate the hot-start taq polymerase and the 40 cycles of 30 s at
94/C176C, 30 s at 50 /C176C and 45 s at 72 /C176C with signal acquisition on a
real-time thermal cycler Rotor Gene 3000 (QIAGEN). The threshold
cycle values (Ct) were determined by using Rotor Gene 6.01 soft-
ware, from amplification plots and compared with the standard
curve generated from serially diluted cell lysate of untreated
MCF-7 control. A negative control was included in each assay,
which was a reaction mixture minus cell extract or a heat/RNase-
treated sample containing the same amount of extract of untreated
cells. In each run of the experiments products of samples were com-
pared with the standard curve made from the serially dilutions of
extracts of untreated cells.
2.3. RNA isolation, reverse transcription and real-time PCR
MCF-7 cells were harvested after 48 h treatment with various
concentrations of chelidonine and total RNA was isolated using
RNX-Plus (SinaClon; Iran) according to the manufacturer’s instruc-
tion and stored at -80 /C176C. The extracted RNA samples were checked
for purity and quality by gel electrophoresis, and the concentra-
tions were measured using Nanodrop 1000. First strand cDNA syn-
thesis was performed according to the protocol suggested for the
Reverse Transcription System (AccuPower RT PreMix, Bioneer)
using oligo(dT) 16primers (Bioneer, South Korea). Quantification
of mRNA levels of the genes was achieved by quantitative real-time
RT-PCR using b2-microglobulin as housekeeping gene. PCR ampli-
fication was carried out in 10 ll reaction volume containing 1 llo f
cDNA, 1x Rotor Gene SYBR Green I Master Mix (QIAGEN; Ger-
many), 0.5 lM of each primer set: hTERT and b2 mg as described
earlier [28], bcl2, bax and dapk1a as listed in Table 1 , using a
calibrator and standard curves for each gene.
2.4. Thermal FRET analysis
The probable interaction of chelidonine with telomerase sub-
strate and interfering with the enzyme activity was estimated
using a simple thermal melting experiment based on Guedin142 S.K. Noureini, H. Esmaili / Chemico-Biological Interactions 223 (2014) 141–149

et al. [29] with small modifications. Based on the method we may
demonstrate the structural stabilization effect of chelidonine on a
double-labeled fluorescence synthetic oligonucleotide of human
telomere sequence rich in guanine, F21T (FAM 30-GGG(TTAGGG) 3-50
TAMRA), which inherently folds to an intramolecular quadruplexstructure. Briefly, F21T at final concentration of 0.25
lM was
heated at 95 /C176C for 10 min, quickly chilled on ice, and incubated
at 37 /C176C for 2 h in presence of sodium cacodylate (10 mM), LiCl
(90 mM) and KCl (10 mM), and various concentration of chelido-
nine 0, 0.25, 1.25, 2.5 and 12.5 lM. Then fluorescence intensity
of the oligonucleotide was measured while heating gradually
(1/C176C/min) using Rotor-Gene 3000 real-time thermal cycler (QIA-
GEN); an increase in melting temperature ( Tm) indicates preferen-
tial ligand binding to the folded rather than the unfolded form.
Differential fluorescence intensity over temperature was calcu-
lated as melting temperature ( Tm) using the Rotor-Gene software
version 1.06. The melting temperature of each sample was
compared to those devoiding chelidonine.
2.5. DNA ladder formation
The MCF-7 cells were treated 48 h with chelidonine at the spec-
ified concentrations. Cellular DNA was isolated and subjected to
agarose gel electrophoresis followed by visualization of bands using
ethidium bromide [30]. The data shown here is from a representa-
tive experiment repeated three times with almost similar results.
2.6. Morphological studies
Forb-galactosidase assay demonstrating senescence, cells after
washing with PBS were fixed for 3–5 min at room temperature in
2% formaldehyde/0.2% glutaraldehyde, followed by washing and
adding fresh senescence-associated b-gal (SA- b-gal) stain solution
as described by Djmiri et al. [31]. Then samples were incubated
4 h at 37 /C176C and no CO 2to develop the dark blue pigment.
For long-term growth, MCF-7 cells were seeded into 25 cm2tis-
sue culture flasks in two sets; control and treated, for 4–5 d until
70–80% confluence before detaching, trypan-blue method counting
and re-plating 0.3 /C2106cells into new culture flasks up to 33 days.
In each passage, the chelidonine-treated set was treated 48 h at the
desired concentration and afterward cells were fed with fresh nor-
mal medium. All the treatments were done in duplicate, the mean
values were presented in the growth, and doubling curves.
2.7. Statistical analysis
Statistical analysis was performed by using standard student ( t)
test and a p< 0.05 was considered as the cut off for significant
difference.
3. Results
3.1. Chelidonine has a strong cytotoxicity in MCF-7 cells
MTT test estimates 8 lMa sL D 50value of chelidonine in MCF7
cells. The cytotoxic effects of chelidonine is quite strong so that celldeath provokes sharply by increasing concentration up to 1.5 lM,
while it reaches to an almost more gradually rate at about 25 lM
concentration and higher ( Fig. 1 A).
3.2. Chelidonine induces apoptosis and autophagy dose dependently
Apoptotic death in MCF-7 cells was stimulated by very low con-
centration (0.5 lM) much stronger than high concentrations (2.5
and 5 lM). DNA fragmentation in MCF-7 cells induced by chelido-
nine after 48 h treatment was clearly visible in agarose gel as pre-
sented in Fig. 1 C.
On the other hand, morphological investigation showed that
apoptosis stimulated by low concentrations of chelidonine was
much stronger than autophagy ( Fig. 2 B), a different mode of cell
death in which a blister appears in cell membrane (black arrows).However, by increasing chelidonine concentration the main mode
of cell death is autophagy as seen in Fig. 2 C.
Quantitative analysis of bax/bcl2 mRNA levels in MCF-7 cells
treated with chelidonine showed a considerable increase at very
low concentrations; while it diminishes to equal amount and even
lower than untreated cells at high concentrations ( Fig. 3 A). This
dose-dependent difference in the strength of chelidonine effects
in stimulation of apoptosis cell death is compatible with the results
that seen in DNA fragmentation by gel electrophoresis. Both meth-
ods show strong apoptogenic effect of chelidonine in MCF-7 cells in
lower concentrations than higher. A quite clear feature of autoph-
agy in MCF-7 treated by high concentrations of chelidonine was
seen in morphological investigations, while apoptotic cells were
still frequent. Fig. 2 C shows more frequent autophagy than apopto-
sis after 48 h treatment of the cells with 5 lM chelidonine. It seems
that the mode of cell death under treatment with chelidonine,
which is generally through apoptosis at low concentrations, shifts
towards autophagy at high concentrations.
A special protein kinase, death-associated protein kinase 1a
(dapk1a), is believed to be involved and play critical role in
autophagy [32]. We evaluated its expression level by quantitative
real-time PCR in cells treated by various concentrations of chelid-
onine. In our experiment condition mRNA level of dapk1a is dose-
dependently elevated by chelidonine to several fold in comparison
with untreated control cells ( Fig. 3 B). DAPk, a Ca2+/calmodulin-
regulated Ser/Thr kinase, is one of the most outstanding among
the commonly shared genes between apoptosis and autophagy,
which associates with the cytoskeleton. That is a tumor suppres-
sor, which is involved in an early p53- dependent transformation
checkpoint and an inhibitor of metastasis [32]. DAPk phosphory-
lates Beclin 1 at T119 within Beclin 1’s BH3 domain, thereby pre-
vents its binding to Bcl-XL, by which it may induce autophagy
[33]. On the other hand, DAPk up-regulates p53 through a mech-
anism that requires p19ARF. As p53 activates either apoptosis or
autophagy, DAPk potentially links both these death pathways
[34]. On the other hand pro-survival signaling that counter apop-
tosis is also inhibited by this kinase [35]. Altogether, expression of
dapk1a in our experiments was strongly induced up to 32 times by
high concentrations of chelidonine, and therefore strongly stimu-
lates autophagy.
3.3. Chelidonine induces cell senescence at very low concentrations
Another mode of cell death especially detectable in long expo-
sure of MCF-7 cells to very low concentrations of chelidonine
was senescence. In treated cells with 0.05 lM chelidonine 48 h
per passage over a period of 33 days, the number of senescent cells
darkly stained by beta-galactosidase method counted in five ran-
dom fields under the microscope ( Fig. 2 D) was increased to about
27% in comparison with 2.5% in un-treated control cells. In parallel,
the doubling time lengthened to 62.6 ± 2.8 h in treated cells, inTable 1
Primer sequences used in real-time PCR.
Bcl2 Forward: 50ATGTGTGTGGAGAGCGTCAA 30
Reverse: 50CAGTTCCACAAAGGCATCCCAG 30
bax Forward: 50TGCTTCAGGGTTTCATCCAG 30
Reverse: 50GGCGGCAATCATCCTCTG 30
dapk1a Forward: 50CAGTGTTGTTGCTCTAGGAAG 30
Reverse: 50GGGACTGCCACAAATGATGAG 30S.K. Noureini, H. Esmaili / Chemico-Biological Interactions 223 (2014) 141–149 143

comparison with 42.43 ± 0.5 h in un-treated controls. This concen-
tration of chelidonine was chosen as no sign of increase in cell
death and apoptosis was detectable by trypan blue exclusionmethod and morphologically inspection of the cells. Fig. 3 C and
D represent the population size and number of doublings respec-
tively from the experiments that repeated two times.
0102030405060708090100
0 10 20 30 40 50 60 70 80 90 100110120130140150160170180190200210220230240250% Viable cells
μM Chelidonine A
B
C
0102030405060708090100
0 100 200 300 400 500 600 700 800 900 1000% viable cells
Berberine concentration (µM)
Fig. 1. (A) Cell viability after 48 h treatment of MCF7 cells with different concentrations of chelidonine as estimated by MTT. Mean values ± standard error of means are
shown. (B) Gel electrophoresis results presenting apoptotic DNA fragmentation in MCF-7 cells induced by 0.5, 2.5 and 5 lM chelidonine from left to right respectively. Crtl 1
and Crtl 2 represent the untreated controls that yielded in different amount of DNA.144 S.K. Noureini, H. Esmaili / Chemico-Biological Interactions 223 (2014) 141–149

3.4. Chelidonine suppresses telomerase through hTERT down
regulation
Quantitative real-time telomere repeat amplification protocol
(qTRAP) measurements showed strong decrease in telomerase
activity to around 50% of untreated MCF7 control cells after 48 h
treatment with about 1 lM chelidonine. Furthermore, the telome-
rase activity depletion was in a dose-dependent manner with a
sharp depletion in very low concentrations, while it is almost com-
pletely inhibited at 8 lM(Fig. 4 D). The quantitative real-time RT-
PCR technique estimates a strong decrease in mRNA copy numbers
of hTERT in MCF7 cells treated with 8 lM chelidonine to 3.5% of
un-treated controls after 48 h ( Fig. 4 ). Similar to the decline pattern
of telomerase activity, hTERT mRNA level reduces steeply to 60%
and to lower than 40% expression level of un-treated cells after
48 h treatment of the cells with 0.1 lM and 1 lM chelidonine,
respectively ( Fig. 4 D). Altogether, telomerase inhibition by chelid-
onine showed the same profile at both enzyme activity and gene
expression level.
Berberine also caused a dose dependent telomerase inhibition
in both activity and mRNA levels in MCF-7, however mRNA level
decreased much stronger than the enzyme activity. Telomerase
inhibition to 50% of un-treated cells in MCF-7 by berberine
occurred at 27 lM after 48 h treatment ( Fig. 4 E).
Thermal FRET analysis indicates only a small increase in Tmof
the double-labeled oligonucleotide F21T; the average DTmwas
measured to no more than 5 /C176C at 1:50 concentration ratio of
F21T:chelidonine. Therefore, the interaction between chelidonine
and telomere sequences is too weak. In other word, chelidonine
may not inhibit telomerase through limitation of its access to the
substrate.4. Discussion
Cell death mechanisms have been long exploited in the treat-
ment of cancer, mainly because malignancies result from an
increase in cell number due to the disruption of the delicate bal-
ance between cell proliferation and death. It is believed that the
elimination of a cell is a complex well-controlled process. In most
cases, stimulation and/or restoration of apoptotic cell death leads
to suppression of transformation and tumorigenesis. However,
apoptosis does not function alone to regulate cell fate, but autoph-
agy, a procedure in which de novo -formed membrane-enclosed
vesicles engulf and consume cellular components, is engaged in a
complex interplay with apoptosis. Although in some situations,autophagy is assumed to serve as a cell survival pathway by sup-
pressing apoptosis, in others, it may lead to death itself, either in
collaboration with apoptosis or as a back-up mechanism when
the former is defective [36].
Natural alkaloids of C. majus have been so far frequently
reported to induce cell death especially through apoptosis induc-
tion. The most important secondary metabolites of isoquinolines
in this plant includes chelidonine, sanguinarine, chelerythrine,
and berberine with different structures and anti-proliferative
effects on cancer cell lines that the detailed mechanisms need
more investigation [37]. Chelidonine, the major benzophenanthri-
dine of C. majus that showed a strong antiproliferative effect in
human breast adenocarcinoma MCF-7, has been under focus here.
Clear morphological changes towards at least two different
modes of cell death appeared after 48 h treatment of MCF-7 cells;
the classical morphology of apoptosis resulted by 0.1 lM concen-
tration of chelidonine while the morphology of single blister for-
mation or blister cell death (BCD) which is also known asAB
CD
Fig. 2. Morphology of untreated MCF-7 cells (A) as viewed using inverted phase contrast microscope (magnification, 200 /C2). MCF-7 cells after 48 h treatment with 0.5 (B) and
5 (C)lM chelidonine towards apoptosis and autophagy respectively (magnification in both, 400 /C2). Black arrows point the autophagic cells. Senescence induced after long-
term treatment with 0.05 lM chelidonine that was evaluated by b-galactosidase staining method (D), the positive dark-blue stained cells (magnification, 100 /C2). (For
interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)S.K. Noureini, H. Esmaili / Chemico-Biological Interactions 223 (2014) 141–149 145

autophagy or oncosis, occurred by 1 lM and higher concentrations.
A similar bimodal cell death has been seen in drug-resistance k562
human leukemia cells when treated with sanguinarine [38,39] .I n
addition to morphological changes towards apoptosis, a sharp
increase in bax/bcl2 expression ratio was seen at very low concen-
tration of chelidonine, so that the highest ratio coincides with the
same concentration at which DNA fragmentation was clearly visi-
ble in gel electrophoresis; about 0.1 lM in our experiments. More
interestingly the detected changes towards apoptosis in all the
three methods; morphological approach, DNA fragmentation and
bax/bcl2 expression ratio, occurred at very low concentration
(around 0.1 to 1 lM) of chelidonine, while it diminishes by increas-
ing concentration.
On the other hand, we identified a very strong dose-dependent
induction in transcription of dapk1a gene, which product is a crit-
ical kinase that regulates becline 1 and promotes autophagy. This isalong with the increase of bax/bcl2 level in treated cells with 0.1
and 1
lM chelidonine that also manifested apoptosis. While apop-
totic cells are still frequently visible, autophagy is strongly
increased by concentration of chelidonine. It seems that this com-
pound stimulates both modes of cell death simultaneously at low
concentration, so that both play important roles synergistically to
reduce cell viability very sharply. However, autophagy fulfills the
main death pathway at higher than 1 lM concentration, while
apoptosis is observed significantly at less than 1 lM chelidonine.
Expression levels of the anti-apoptotic bcl2 gene is increased by
increasing concentration of chelidonine (as seen in Fig. 3 A that
after an initial increase, bax/bcl2 declines to even lower thanuntreated cells) and this resistance to apoptosis may contribute
to boost autophagy by induction of dapk1a.
In MCF-7 cells that wild type p53 is expressed, dapk1a can stim-
ulate this protein through inhibition of mdm2. This may suggest
that p53 is also overexpressed by chelidonine. Activation of p53
protein leads to both apoptosis and autophagy [36]. Therefore,
p53 may link between all the modes of cell death that boosted
by various concentration of chelidonine in this cell line as cell
senescence may also be stimulated by p53, which in turn results
in p21 induction and cell arrest.
There are some other compounds that stimulate both apoptosis
and autophagy in cancer cells. Such a bimodal cell death induction
in a dose dependent manner has been already reported in several
cancer cells under treatment with sanguinarine [38–40] , another
natural benzophenanthridine alkaloids that is structurally homolo-
gous to chelidonine. Sanguinarine at a low concentration (1.5 lg/
ml equal to 0.5 lM) induces apoptosis, while at high concentration
(12.5 lg/ml equal to 4.15 lM) induces oncosis-blister cell death in
p53 null K562 human erythroleukemia cells that is rather resistant
to the induction of apoptosis [41]. It is important to note that the
compounds with such effects might be valuable chemotherapeutic
agents for most cancers, especially those develop drug resistance
[38,40] . However, our data suggest chelidonine as a more valuable
anti-cancer natural biochemical than sanguinarine, because the
latter alkaloid is a strong cytotoxic compound (IC 50value of san-
guinarine is 3 ± 0.25 lM in MCF-7 cells after 48 h using MTT test
[personal communication]). Sanguinarine shows a very high affin-
ity to interact with DNA [42], which suggests the high probability
AB
00.511.522.533.5
0 0.1 2 8bax/bcl2 expression ratio
µM chelidonine**
0510152025303540
0 0.1 1 5 8relative expression of dapk1a
μM chelidonine
CD
020406080100120140160
0 5 10 15 20 25 30 35population size (x million)
Time (in days)024681012141618
0 5 10 15 20 25 30 35population doublings
Time (in days)
Fig. 3. Dose-dependent alterations of bax/bcl2 (A) and dapk1a (B) mRNA levels in breast cancer cell lines MCF-7, 48 h treated with chelidonine, p60.05;⁄p60.01.
Population size (C) and doubling time (D) changes in MCF-7 cells treated with 0.05 lM chelidonine (triangle) in comparison with the untreated control (diamond) after a few
passages.146 S.K. Noureini, H. Esmaili / Chemico-Biological Interactions 223 (2014) 141–149

for the genotoxic and mutagenic side effects [43,44] . The structure
of chelidonine differs from sanguinarine only by having a hydroxyl
group, while it is also electrostatically neutral in contrast with pos-
itively charged sanguinarine. These may interfere with DNA inter-
calation and result in low cytotoxicity of chelidonine.
BIX-01294 a selective inhibitor of euchromatic histone-lysine
N-methyltransferase 2 has been identified as a cancer specific
strong autophagy inducer in estrogen receptor (ESR)-negative
SKBr3 and ESR-positive MCF-7 breast cancer cells, HCT116 colon
cancer cells, and importantly, in primary human breast and colon
cancer cells. Exposure to BIX reduces cell viability in MCF-7 cellsmore efficiently than in mammary epithelial MCF10A cell line.
However, BIX accumulates intracellular reactive oxygen species(ROS), augments mitochondrial superoxide, hydrogen peroxide
and glutathione redox potential in both cytosol and mitochondria
[45], an almost similar mechanism as sanguinarine but not chelid-
onine Salinomycin is an anti-cancer chemical with preferential
cytotoxicity in several cancer stem cells including breast cancer
by blocking Wnt/ b-catenin pathway, which is critical for stem cell
self-renewal. However, it is relatively non-toxic to primary cells
[46]. In addition to induction of apoptosis through conventional
caspase mediated apoptotic pathways, salinomycin triggers aD E
*
*
*+
+
+
0102030405060708090100
0 0.1 1 8
µM Chelidonine% telomerase activity
% hTERT/β2mg expression ratio
+
+
+* **
0102030405060708090100
0 3.6 27 54
µM Berberine% telomerase ac/g415vity
% hTERT/β2mg expression ra/g415o
CAB
Fig. 4. Standard curve and amplification plot of a representative experiment of qTRAP analysis (A). Cell lysates of untreated MCF-7 was serially diluted 1–5 a nd the next steps
were followed as mentioned in Section 2.2. A negative control was included which contained lysis buffer without cell extract (the black curve). The amplification plot of
standards were shown in a (blue; cell extract without dilution, pink; 1/5, green; 1/25, orange; 1/125). The qTRAP standard curve with efficiency facto rs is seen in B.
Amplification plot of TRAP reactions is seen in C: red; un-treated MCF-7 cells, blue, green and pink extracts of 48 h treated cells with 0.1, 1 and 8 lM chelidonine respectively.
Telomerase activity as measured by q-TRAP assay and hTERT transcription levels using quantitative real-time RT-PCR technique in MCF-7 cells after 4 8 h treatment with
different concentrations of chelidonine and berberine were presented in D and E respectively. The mean value ± SEM of four logical repeats each includ ing at least three
samples for different concentrations of was presented,⁄p60.05,+p60.01. (For interpretation of the references to color in this figure legend, the reader is referred to the web
version of this article.)S.K. Noureini, H. Esmaili / Chemico-Biological Interactions 223 (2014) 141–149 147

massive autophagic response substantially stronger than to com-
monly used autophagic inducer Rapamycin in breast cancer cells
and to lesser degree in human normal dermal fibroblasts [47].
Although any dose-dependency for bimodal cell death has not
been described for BIX and salinomycin, both chelidonine and
sanguinarine promote both apoptotic and autophagic cell death
dose dependently.
Quantitative TRAP assay measured a very low level of telome-
rase activity in treated cells; therefore, most likely the inhibition
mechanism is depletion of the relative amount of the functional
ribonucleoprotein by chelidonine. Telomerase regulation albeit
very complicated, is mainly through transcription regulation of
the catalytic subunit of the enzyme [48]. Our data showed that
in treated cells hTERT mRNA level followed the same diminution
pattern as the telomerase activity. This suggests that telomeraseinhibitory effect of chelidonine is most likely by decreasing the
transcription of hTERT gene.
However, a potential telomerase inhibitor compound may also
interfere with the enzyme activity by some additional mecha-
nisms, which the most remarkable one is limitation of enzyme
accessibility to its substrate. As melting temperature of synthetic
telomeric oligonucleotide, F21T, in presence of chelidonine did
not considerably increased, the enzyme activity could not be inhib-
ited through stabilization of the substrate into folded state; there-
fore the limitation of enzyme accessibility to its substrate is failed.
This is compatible with other publications indicating only a slight
DNA binding capacity of chelidonine [49]. In this reference, the
authors have reported that cytotoxicity of sanguinarine and chel-
erythrine among alkaloids of C. majus is through a rapid intensive
DNA damage, while chelidonine induces intensive DNA damage in
15–20% of treated cells only in 24 h.
In comparison, chelidonine even at sub-micromolar concentra-
tions is much more effective on telomerase inhibition than berber-
ine, a known natural alkaloid that inhibits telomerase [50]. In our
hand, qTRAP measurements in MCF-7 cells treated with berberine
estimated a strong repression of telomerase to around 10% of
untreated cells at its LD 50value (equal to 54 lM as evaluated by
MTT method). Bearing in mind the cytotoxicity of chelidonine
and berberine and the concentration of each compound at which
telomerase is inhibited to 50%, 0.5 and 27 lM respectively, chelid-
onine showed a very stronger anti-telomerase efficiency than
berberine.
In conclusion, chelidonine is proposed as a very potent anti-
cancer bio-organic compound as it strongly inhibits telomerase
and stimulates multiple mechanisms of cell death including apop-
tosis, autophagy and senescence. This compound probably induces
global changes in gene expression profile of treated MCF-7 cells
and stimulates several pathways to suppress cancer cell growth.
Conflicts of interest
The authors declare that there are no conflicts of interest.
Author contributions
S. Kazemi Noureini (Ph.D.) has done designing and performing
the experiments, data analysis and manuscript preparation. H.
Esmaili (M.Sc. student) has collected data related to telomerase
activity and expression as part of his M.Sc. thesis.
Transparency Document
TheTransparency document associated with this article can be
found in the online version.Acknowledgments
We would like to thank the anonymous reviewers for their
helpful comments and suggestions. This work was supported by
the Iran National Science Foundation (INSF) granted to S. Kazemi
Noureini.
References
[1]D.J. Kim, B. Ahn, B.S. Han, H. Tsuda, Potential preventive effects of Chelidonium
majus L. (Papaveraceae) herb extract on glandular stomach tumor
development in rats treated with N-methyl-N0-nitro-N nitrosoguanidine
(MNNG) and hypertonic sodium chloride, Cancer Lett. 112 (1997) 203–208 .
[2]A. Lohninger, F. Hamler, Chelidonium majus L. (Ukrain) in the treatment of
cancer patients, Drugs Exp. Clin. Res. 18 (Suppl.) (1992) 73–77 .
[3]M.L. Colombo, E. Bosisio, Pharmacological activities of Chelidonium majus L.
(Papaveraceae), Pharmacol. Res. 33 (1996) 127–134 .
[4]D. Habermehl, B. Kammerer, R. Handrick, T. Eldh, C. Gruber, N. Cordes,
Proapoptotic activity of Ukrain is based on Chelidonium majus L. alkaloids and
mediated via a mitochondrial death pathway, BMC Cancer 6 (2006) 14 .
[5]J. Huh, A. Liepins, J. Zielonka, C. Andrekopoulos, B. Kalyanaraman, A. Sorokin,
Cyclooxygenase 2 rescues LNCaP prostate cancer cells from sanguinarine-
induced apoptosis by a mechanism involving inhibition of nitric oxidesynthase activity, Cancer Res. 66 (2006) 3726–3736
.
[6]S. Jantova, L. Cipak, S. Letasiova, Berberine induces apoptosis through a
mitochondrial/caspase pathway in human promonocytic U937 cells, Toxicol. In
Vitro 21 (2007) 25–31 .
[7]S.K. Noureini, M. Wink, Transcriptional down regulation of hTERT and
senescence induction in HepG2 cells by chelidonine, World J. Gastroenterol.
15 (2009) 3603–3610 .
[8]J. Hammerová, S. Uldrijan, E. Táborská, I. Slaninová, Benzo[c]phenanthridine
alkaloids exhibit strong anti-proliferative activity in malignant melanoma cells
regardless of their p53 status, J. Dermatol. Sci. 62 (2011) 22–35 .
[9]A. Philchenkov, V. Kaminskyy, M. Zavelevich, R. Stoika, Apoptogenic activity of
two benzophenanthridine alkaloids form Chelidonium majus L. does not
correlate with their DNA damaging effects, Toxicol. In Vitro 22 (2008) 287–295 .
[10] N. Cordes, L. Plasswilm, M. Bamberg, H.P. Rodemann, Ukrain, an alkaloid
thiophosphoric acid derivative of Chelidonium majus L. protects human
fibroblasts but not human tumor cells in vitro against ionizing radiation, Int.
J. Radiat. Biol. 78 (2002) 17–27 .
[11] V. Kaminskyy, K.-W. Lin, Y. Filyak, R. Stoika, Differential effect of sanguinarine,
chelerythrine and chelidonine on DNA damage and cell viability in primary
mouse spleen cells and mouse leukemic cells, Cell Biol. Int. 32 (2008) 271–277 .
[12] G. Mazzanti, A. Di Sotto, A. Franchitto, C.L. Mammola, P. Mariani, S.
Mastrangelo, F. Menniti-Ippolito, A. Vitalone, Chelidonium majus is not
hepatotoxic in Wistar rats, in a 4 weeks feeding experiment, J.
Ethnopharmacol. 126 (3) (2009) 518–524 .
[13] O. Hohenwarter, K. Strutzenberger, H. Katinger, A. Liepins, J.W. Nowicky,
Selective inhibition of in vitro cell growth by the antitumor drug Ukrain, Drugs
Exp. Clin. Res. 18 (Suppl.) (1992) 1–4 .
[14] K.E. Huffman, S.D. Levene, V.M. Tesmer, J.W. Shay, W.E. Wright, Telomere
shortening is proportional to the size of the G-rich telomeric 30-overhang, J.
Biol. Chem. 275 (2000) 19719–19722 .
[15] M. Meyerson, C.M. Counter, E.N. Eaton, L.W. Ellisen, P. Steiner, S.D. Caddle,
HEST2 , the putative human telomerase catalytic subunit gene, is up-regulated
in tumor cells and during immortalization, Cell 90 (1997) 785–795 .
[16] E. Hiyama, T. Yokoyama, N. Tatsumoto, K. Hiyama, Y. Imamura, Y. Murakami,
Telomerase activity in gastric cancer, Cancer Res. 55 (1995) 3258–3262 .
[17] L.L. Smith, H.A. Coller, J.M. Roberts, Telomerase modulates expression of
growth-controlling genes and enhances cell proliferation, Nat. Cell Biol. 5
(2003) 474–479 .
[18] S.A. Stewart, R.A. Weinberg, Telomeres: cancer to human aging, Annu. Rev. Cell
Dev. Biol. 22 (2006) 531–557 .
[19] D.L. Gómez, H.G. Farina, D.E. Gómez, Telomerase regulation: a key to
inhibition?, Int J. Oncol. 43 (2013) 1351–1356 .
[20] B. Maji, S. Bhattacharya, Advances in the molecular design of potential
anticancer agents via targeting of human telomeric DNA, Chem. Commun.
(Camb) (2014). PMID:24695755 .
[21] I. Joseph, R. Tressler, E. Bassett, C. Harley, C.M. Buseman, P. Pattamatta, W.E.
Wright, J.W. Shay, N.F. Go, The telomerase inhibitor imetelstat depletes cancer
stem cells in breast and pancreatic cancer cell lines, Cancer Res. 70 (2010)
9494–9504 .
[22] M. Ruden, N. Puri, Novel anticancer therapeutics targeting telomerase, Cancer
Treat. Rev. 39 (2013) 444–456 .
[23] A. Paul, S. Das, J. Das, A. Samadder, A.R. Khuda-Bukhsh, Cytotoxicity and
apoptotic signalling cascade induced by chelidonine-loaded PLGAnanoparticles in HepG2 cells in vitro and bioavailability of nano-chelidonine
in mice in vivo, Toxicol. Lett. 222 (2013) 10–22
.
[24] T. Mosmann, Rapid colorimetric assay for cellular growth and survival;
application to proliferation and cytotoxicity assays, J. Immunol. Methods 65
(1983) 55–63 .148 S.K. Noureini, H. Esmaili / Chemico-Biological Interactions 223 (2014) 141–149

[25] N.W. Kim, M.A. Piatyszek, K.R. Prowse, C.B. Harley, M.D. West, P.L. Ho, Specific
association of human telomerase activity with immortal cells and cancer,
Science 266 (1994) 2011–2050 .
[26] M.M. Bradford, A rapid and sensitive method for quantitation. For each of
control and/in utilizing the principle of protein-dye binding, Anal. Biochem. 72
(1976) 248–254 .
[27] M. Hou, X. Dawei, M. Byorkltolm, A. Gruber, Real-Time quantitative telomeric
repeat amplification protocol Assay for the detection of telomerase activity,
Clin. Chem. 47 (2001) 519–524 .
[28] S.K. Noureini, M. Wink, Antiproliferative effects of crocin in HepG2 cells by
telomerase inhibition and hTERT down-regulation, Asian Pac. J. Cancer Prev.13 (2012) 2305–2309
.
[29] A. Guédin, L. Lacroix, J.L. Mergny, Thermal melting studies of ligand DNA
interactions drug–DNA interaction protocols, Methods Mol. Biol. 613 (2010)
25–35 .
[30] Y.F. Shi, M.G. Szalay, L. Paskar, B.M. Sahai, M. Boyer, B. Singh, D.R. Green,
Activation-induced cell death in T cell hybridomas is due to apoptosis.
Morphologic aspects and DNA fragmentation, J. Immunol. 144 (1990) 3326–3333
.
[31] G.P. Dimri, X. Lee, G. Basile, M. Acosta, G. Scott, C. Roskelley, A biomarker that
identifies senescent human cells in culture and in aging skin in vivo, Proc. Natl.
Acad. Sci. U.S.A. 92 (1995) 9363–9367 .
[32] S. Bialik, A. Kimchi, The death-associated protein kinases: structure, function
and beyond, Annu. Rev. Biochem. 75 (2006) 189–210 .
[33] E. Zalckvar, H. Berissi, L. Mizrachy, Y. Idelchuk, I. Koren, M. Eisenstein, DAPk-
mediated phosphorylation on the BH3 domain of Beclin-1 promotes
dissociation of Beclin-1 from Bcl- XL to induce autophagy, EMBO Rep. 10
(2009) 285–292 .
[34] B. Inbal, S. Bialik, I. Sabanay, G. Shani, A. Kimchi, DAP kinase and DRP-1
mediate membrane blebbing and the formation of autophagic vesicles during
programmed cell death, J. Cell Biol. 157 (2002) 455–468 .
[35] C.H. Chen, W.J. Wang, J.C. Kuo, H.C. Tsai, J.R. Lin, Z.F. Chang, R.H. Chen,
Bidirectional signals transduced by DAPK–ERK interaction promote the
apoptotic effect of DAPK, EMBO J. 24 (2005) 294–304 .
[36] A. Eisenberg-Lerner, S. Bialik, H.U. Simon, A. Kimchi, Life and death partners:
apoptosis, autophagy and the cross-talk between them, Cell Death Differ. 16
(2009) 966–975 .
[37] J.J. Lu, J.L. Bao, X.P. Chen, M. Huang, Y.T. Wang, Alkaloids isolated from natural
herbs as the anticancer agents, Evid. Based Complement. Alternat. Med. (2012)
485042, http://dx.doi.org/10.1155/2012/485042 .
[38] P. Weerasinghe, S. Hallock, S.C. Tang, B. Trump, A. Liepins, Sanguinarine
overcomes P-glycoprotein-mediated multidrug-resistance via induction of
apoptosis and oncosis in CEM-VLB 1000 cells, Exp. Toxicol. Pathol. 58 (1)
(2006) 21–30 .[39] P. Weerasinghe, S. Hallock, S.C. Tang, A. Liepins, Role of Bcl-2 family proteins
and caspase-3 in sanguinarine-induced bimodal cell death, Cell Biol. Toxicol.
17 (2001) 371–381 .
[40] Z. Ding, S.C. Tang, P. Weerasinghe, X. Yang, A. Pater, A. Liepins, The alkaloid
sanguinarine is effective against multidrug resistance in human cervical
cells via bimodal cell death, Biochem. Pharmacol. 63 (8) (2002) 1415–1421 .
[41] T. Kobayashi, S. Ruan, K. Clodi, K.O. Kliche, H. Shiku, M. Andreeff, W. Zhang,
Overexpression of Bax gene sensitizes K562 erythroleukemia cells to apoptosis
induced by selective chemotherapeutic agents, Oncogene 16 (12) (1998)
1587–1591 .
[42] A. Saran, S. Srivastava, E. Coutinho, M. Maiti, 1H NMR investigation of the
interaction of berberine and sanguinarine with DNA, Indian J. Biochem.
Biophys. 32 (2) (1995) 74–77 .
[43] K.M. Ansari, M. Das, Potentiation of tumour promotion by topical application
of argemone oil/isolated sanguinarine alkaloid in a model of mouse skin
carcinogenesis, Chem. Biol. Interact. 188 (3) (2010) 591–597 .
[44] M. Das, K.M. Ansari, A. Dhawan, Y. Shukla, S.K. Khanna, Correlation of DNA
damage in epidemic dropsy patients to carcinogenic potential of argemone oiland isolated sanguinarine alkaloid in mice, Int. J. Cancer 117 (5) (2005) 709–
717
.
[45] Y. Kim, Y.S. Kim, D.E. Kim, J.S. Lee, J.H. Song, H.G. Kim, D.H. Cho, S.Y. Jeong, D.H.
Jin, S.J. Jang, H.S. Seol, Y.A. Suh, S.J. Lee, C.S. Kim, J.Y. Koh, J.J. Hwang, BIX-01294
induces autophagy-associated cell death via EHMT2/G9a dysfunction andintracellular reactive oxygen species production, Autophagy 9 (12) (2013)
2126–2139
.
[46] D. Lu, M.Y. Choi, J. Yu, J.E. Castro, T.J. Kipps, D.A. Carson, Salinomycin inhibits
Wnt signaling and selectively induces apoptosis in chronic lymphocytic
leukemia cells, Proc. Natl. Acad. Sci. U.S.A. 108 (2011) 13253–13257 .
[47] J.R. Jangamreddy, S. Ghavami, J. Grabarek, G. Kratz, E. Wiechec, B.A.
Fredriksson, R.K. Rao Pariti, A. Cies ´lar-Pobuda, S. Panigrahi, M.J. Łos,
Salinomycin induces activation of autophagy, mitophagy and affects
mitochondrial polarity: differences between primary and cancer cells,
Biochim. Biophys. Acta 1833 (9) (2013) 2057–2069 .
[48] C.M. Counter, M. Meyerson, E.N. Eaton, L.W. Ellisen, S.D. Caddle, D.A. Haber,
Telomerase activity is restored in human cells by ectopic expression of hTERT(hEST2), the catalytic subunit of telomerase, Oncogene 16 (1998) 1217–1222
.
[49] V. Kaminskyy, O. Kulachkovskyy, R. Stoika, A decisive role of mitochondria in
defining rate and intensity of apoptosis induction by different alkaloids,
Toxicol. Lett. 177 (2008) 168–181 .
[50] N. Sriwilaijareon, S. Petmitr, A. Mutirangura, M. Ponglikitmongkol, P. Wilairat,
Stage specificity of Plasmodium falciparum telomerase and its inhibition by
berberine, Parasitol. Int. 51 (1) (2002) 99–103 .S.K. Noureini, H. Esmaili / Chemico-Biological Interactions 223 (2014) 141–149 149