Linezolid

Abstract (900 caractere)

In February 2013, one Staphylococcus hominis strain found linezolid-resistant by routine investigations was isolated from bloodstream of a hospitalized patient in the Paediatric/ neonatal ICU of the Clinical Emergency Children Hospital, Bucharest, Romania. The isolate was received by the Reference Laboratory for Nosocomial Infections and Antimicrobial Resistance within the “Cantacuzino” National Institute of Research, Bucharest, Romania, for linezolid-resistance confirmation and further analysis.

The isolate was confirmed multidrug-resistant, being susceptible only to trimethoprim-sulfamethoxazole, rifampin, quinupristin-dalfopristin and vancomycin. Minimum inhibitory concentration (MIC) of linezolid by E-test was higher than 128 µg/mL. Molecular biology techniques revealed that this isolate harboured a cfr gene and, also, had a G2603T mutation in domain V region of 23S rRNA.

As far as we know, this is the first report of a linezolid-resistant strain of staphylococci in Romania and the first report of a strain of Staphylococcus hominis harboring the G2603T mutation in domain V of the 23S rRNA in Europe.

Keywords: linezolid, resistant, cfr gene, domain V 23S rRNA, Staphylococcus hominis

Rezumat

În februarie 2013, o tulpină de Staphylococcus hominis rezistentă la linezolid prin investigațiile de rutină, a fost izolată din sânge de la un pacient internat în secția de pediatrie/ ATI neonatologie a Spitalului Clinic de Copii de Urgență, București, România. Izolatul a fost primit de Laboratorul de Referință pentru Infecții Nosocomiale și Rezistență la Antibiotice din cadrul Institutului Național de Cercetare "Cantacuzino", București, România, pentru confirmarea rezistenței la linezolid și analize suplimentare.

Izolatul a fost confirmat ca multirezistent la antibiotice, fiind susceptibil doar la trimetoprim-sulfametoxazol, rifampicină, quinupristin-dalfopristin și vancomicină, iar intermediar la ciprofloxacin. Concentrația minimă inhibitorie (CMI) a linezolidului prin E-test a fost mai mare decât 128 µg/mL. Tehnicile de biologie moleculară au arătat că acest izolat purta gena cfr și, de asemenea, a avut o mutație G2603T în domeniul V al subunității 23S a ARNr.

Din ceea ce știm, acesta este prima raportare a unei tulpini de stafilococ rezistent la linezolid în România și prima raportare a unei tulpini de Staphylococcus hominis prezentând mutația G2603T în domeniul V al subunității 23S a ARNr în Europa.

Cuvinte cheie: linezolid, rezistent, gena cfr, domeniul V 23S ARNr Staphylococcus hominis

Introduction/ Background

Gram-positive microorganisms are a predominant cause of serious infections across the world [Menichetti, 2005]. Currently, serious infections caused by both CoNS, and methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant enterococci (VRE) are often treated with vancomycin or linezolid. Many studies show that tigecycline, as compared to vancomycin and linezolid, is safe and effective in hospitalized patients with serious infections caused by MRSA [Florescu I, 2008; Kreis C., 2013]. Tigecycline resistance was rare in isolates causing clinically significant infections [Hope R., 2010; Dabul AN., 2014].

Linezolid is a synthetic antibiotic [(S)-N-({3-[3-fluoro-4-(morpholin-4-yl)phenyl]-2-oxo-1,3-oxazolidin-5-yl}methyl)acetamide] [Brickner S.J. 1996], the first member of oxazolidinone class of antibiotics, discovered in the 1990s and approved for clinical use in 2000 by the U.S. Food and Drug Administration (FDA).

When administered for short periods, linezolid is a relatively safe drug. It can be used in patients of all ages and in people with liver disease or poor kidney function. The common adverse effects include headache, diarrhea and nausea. The serious adverse effects have been associated with long-term use. When used for more than two weeks it can cause bone marrow suppression and low platelet counts, particularly. It may cause sometimes irreversible chemotherapy-induced peripheral neuropathy, optic nerve damage and lactic acidosis (a buildup of lactic acid in the body), all most likely due to mitochondrial toxicity when used for longer periods [Barnhill A.E, 2012]. In spite of that, it appears to be more cost-effective than generic alternatives such as vancomycin [Grau, 2008], mostly because of the possibility of switching from intravenous to oral administration as soon as patients are stable enough, without the need for dose adjustments.

Linezolid can inhibit bacterial protein synthesis by binding to the 50S subunit of the bacterial ribosome via interaction with the domain V of 23S rRNA of Gram-positive bacteria, thereby preventing formation of the N-formyl methionyl-tRNA-mRNA-70S ribosomal tertiary complex. It stops the growth of bacteria by disrupting their production of proteins. It is a bacteriostatic agent, not bactericidal. Based on the unique mechanism of action, it demonstrated potent antimicrobial activity in the treatment of serious infections caused by antibiotic resistant Gram-positive bacteria, including methicillin-resistant Staphylococcus aureus (MRSA), methicillin-resistant coagulase negative staphylococci (MR-CoNS), vancomycin-resistant enterococci (VRE) and multidrug-resistant (MDR) Streptococcus pneumoniae (Diekema & Jones, 2001; Shinabarger D., 1999]. Its pharmacokinetic and pharmacodynamic properties have led to its increasing use for the main indications, i.e., nosocomial and community-acquired pneumonia, complicated skin and soft tissue infections [Grau et al., 2007]. At the introduction of linezolid, it was claimed that the resistance would be rare and that it would be not prone to cause cross-resistance [Zhou W., 2015].

However, the first alert with linezolid-resistant methicillin-resistant S. aureus (MRSA) was reported in 2001, in North America (Tsiodras S., 2001). After this year, linezolid-resistant staphylococci and enterococci have been increasingly reported [Gu B., 2013; Cai JC., 2012; Chen H., 2013; Potoski BA., 2006].

In the United States of America (U.S.A.), through a program named LEADER, the resistance to linezolid has been monitored and tracked since 2004. The results showed that the resistance has remained stable and extremely low [Jones et al., 2007; 2008; 2009; Gu B., 2013; Cai J.C., 2012; Chen H., 2013; Potoski B.A., 2006; Mutnick A.H., 2003; Mendes R.E., 2010]. A similar, surveillance network called the "Zyvox Annual Appraisal of Potency and Spectrum Study", or ZAAPS has been conducted since 2002 to 2009 in european medical centers [http://www.biowebspin.com/pubadvanced/article/21571621/#sthash.paEjwX6Y.dpuf; Flamm RK., 2013]. As of 2007, overall resistance to linezolid in 23 countries was less than 0.2%, and nonexistent among streptococci. Resistance was found in Brazil, China, Ireland, and Italy, among CoNS (0.28% of samples resistant), enterococci (0.11%), and S. aureus (0.03%) [Jones, 2009]. Between 2001 – 2006, in the United Kingdom and Ireland, no resistance was found in staphylococci collected from bacteraemia cases [Hope, 2008]. Resistance in enterococci has been reported [Auckland, 2002].

The resistance mechanisms to linezolid were described. One mechanism involve the mutations at the central loop of one and more alleles of the domain V region on the 23S rRNA gene (Sorlozano et al., 2010; Bongiorno et al., 2010). Various mutations have been described (Hong et al., 2007; Lincopan et al., 2009; Sorlozano et al., 2010; de Almeida, 2013). Other mechanism involve the acquisition of the chloramphenicol-florfenicol resistance (cfr) gene encoding the 23S rRNA methyltransferase (Mendes, 2008; Quiles-Melero et al., 2013; Campanile et al., 2013; Huang, 2014), that methylates the adenosine at position 2503 in 23S rRNA (E. coli 23S rRNA gene numbering), conferring resistances to five classes of antimicrobial agents, i.e., phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A, a phenotype that has been termed PhLOPSA [Kehrenberg et al., 2005; Long K.S., 2006; Toh et al., 2007; Shore A.C., 2010]. Cfr gene is generally plasmid borne or chromosomally located [Kehrenberg C., 2007; Toh S.M., 2007] and transpose associated. It can be horizontally transmitted between species and this mode of transmission is difficult to prevent and stop [Kehrenberg et al., 2007; Nian et al., 2012]. The cfr gene was originally identified in CoNS from animals [Kehrenberg C., 2006; Schwarz S., 2000]. It has also been found in a very limited number of S. aureus strains and CoNS from humans [Mendes R.E., 2008, 2010; Morales G., 2010; Toh S.M., 2007]. Mutations or deletions in genes encoding the 50S ribosomal subunit proteins L3 (de Almeida et al., 2013), L4 and L22 (encoded by the rplC, rplD and rplV genes) represents others resistance mechanisms [Holzel C.S., 2010; Shaw & Barbachyn, 2011; Long K.S. & Vester B., 2012].

Little attention has been put to CoNS, but this strains may become resistant to linezolid [Petinaki et al., 2009; Bongiorno et al., 2010; Mendes et al., 2010], and it can represent a neglected reservoir of cfr-mediated resistance. It have frequently emerged among patients in many countries, including North America (USA, Mexico), South America (Brazil), Europe (Greece, Spain, Italy, France, Ireland), and Asia (India) [Gu B., 2013; Potoski BA., 2006; Mutnick AH., 2003; Mendes RE., 2010]. Such strains have rarely been reported in China [Cai JC., 2012; Chen H., 2013; Yang XJ., 2013, Zhou W, 2015].

In some hospital departments, especially Intensive Care Units (ICUs), the antibiotic pressure, the inadequate use of antibiotics and the difficulty in detecting certain resistance phenotypes led to a major increase in bacterial resistance rates worldwide (Shorr & Lipman, 2007) and favored the development of multiple resistances in microorganisms such as Staphylococcus spp. (MacKenzie et al., 2007).

A strain of CoNS linezolid-resistant was received within the National Program of Nosocomial Infections Surveillance for linezolid resistance confirmation and further analysis. This was the first linezolid-resistant bacteria received at the Reference National Centres Romania for confirmation. The correct and rapid identification of linezolid-resistant strains is important for limiting dissemination of highly-resistant clones. This study aimed at setting-up an algorithm for identification of such strains and elucidating mechanisms involved in linezolid resistance of the received strain.

Materials and Methods

Clinical data

In January, 2013 patient, 6 month of age, male was admitted in the Paediatric/ neonatal ICU of the Clinical Emergency Children Hospital, Bucharest, a 426 – bed emergency children hospital in Southeast Romania.

The patients suffered from acute bronchiolitis, acute respiratory failure, generalized tonic-clonic seizures, laryngeal stridor and was born with underdeveloped lungs.

Investigatii – S. aureus, CoNS??????????????daca a avut inainte

Empirical therapy was instituted with a combination of antibiotics targeting both Gram-negative and positive bacteria. The patient received the following antibiotics: linezolid, gentamicin, meropenem, fluconazole (26 – 01/31/2013 period); amikacin, fluconazole, meropenem, vancomycin (1 – 02/12/2013); colistin, meropenem, linezolid, amikacin, fluconazole (13 – 02/18/2013); ertapenem, colistin, fluconazole, amikacin, linezolid (19 – 02/20/2013). On 02/22/2013, a Gram-positive coccus was isolated. Blood samples were processed using the BacT/ ALERT 3D automated system (bioMérieux, Marcy-l’Etoile, France), and subcultured on Columbia plate containing 7% sheep blood. CoNS were identified by colony morphology, Gram staining, catalase testing and coagulase assays. Antimicrobial susceptibility testing was performed in order to establish the optimum treatment. The results indicated that the isolated strain was multidrug-resistant, including linezolid (previously used in empirical therapy). Meantime, the patient developed cardiac arrest and died. He was diagnosed with acute respiratory failure.

CoNS linezolid resistance confirmation

Strain identification

In April, 2013 the CoNS strain isolated from the previously mentioned clinical case was received by the Reference Laboratory for Nosocomial Infections and Antimicrobial Resistance within the “Cantacuzino” National Institute of Research, Bucharest, Romania, for linezolid resistance confirmation and further analysis. It was cultivated on 7% sheep blood agar Columbia (Oxoid) and Mannitol Salt agar (Oxoid). Characteristic colonies were identified using standard microbiological methods: Gram staining, catalase, oxidase, bound and free coagulase. Biochemical characterization was performed by using an automated method, with Vitek2 system (bioMérieux, France).

Phenotypic antimicrobial susceptibility testing

Kirby-Bauer disk diffusion method was performed following the CLSI 2013 guidelines, using the following antibiotics: benzylpenicillin (10 U), cefoxitin (30 µg), erythromycin (15), clindamycin (2), kanamycin (30), gentamicin (10), tobramycin (10), ciprofloxacin (5), tetracycline (30), rifampicin (5), chloramphenicol (30), trimethoprim-sulfamethoxazole (1.25/ 23.75), quinupristin-dalfopristin (15), linezolid (30). The MICs of linezolid and vancomycin were determined by E-test (AB Biodisk, Solna, Sweden). Resistance to linezolid was defined as an MIC > 4 μg/mL. Sensitivity to vancomycin was defined as an MIC <= 4 μg/mL.

Molecular detection of linezolid resistance

DNA extraction

Total genomic DNA used in all PCR reactions was obtained by using NucleoSpin Tissue Macherey-Nagel kit according to manufacturer's instructions.

Polymerase chain reaction and sequencing of cfr and domain V 23S rRNA genes

For cfr gene detection by PCR we used the following primers described by Kehrenberg and Schwarz (2006), forward, 5'TGAAGTATAAAGCAGGTTGGGAGTCA3' and reverse, 5'ACCATATAATTGACCACAAGCAGC3'. The specificity of amplification was checked by Sanger sequencing with the same primers.

To amplify the V domain of the 23S rRNA gene we used the following primers: forward, 5'GCGGTCGCCTCCTAAAAG3', and reverse, 5'ATCCCGGTCCTCTCGTACTA3', expecting an 420 bp amplicon (Pillai et al., 2002). Sanger sequencing was used to identify potential mutations, that could explaine the linezolid resistance.

For PCR and sequencing reactions a Corbett Research PCR Thermal Cycler was used. An ABI PRISM 3130 Genetic Analyzer Applied Biosystems was used for Sanger method for DNA sequencing.

The BioEdit program was used to compare the obtained sequences of cfr and V domain of 23S rRNA genes with the corresponding genes sequences from GenBank- National Center for Biotechnology Information (NCBI) (articol citat).

DNA sequences obtained were aligned with the corresponding nucleotide sequences from a linezolidsusceptible S. aureus reference strain (GenBank accession number X68425).

Results

The strain was identified as Staphylococcus hominis by Vitek2 system. The antimicrobial susceptibility testing results are presented in table I.

Table I. S. hominis antimicrobial susceptibility testing and interpretation by 2013 guidelines of the EUCAST

Minimum inhibitory concentration (MIC) of linezolid by E-test was more than 128 µg/mL (Fig. 1.), that mean a high resistance level; MIC of vancomycin was 3 µg/mL (Fig. 2.), that means susceptibility to this antibiotic.

Fig. 1. Susceptibility test by E-test for linezolid (original photo)

Fig. 2. Susceptibility test by E-test for vancomycin (original photo)

The PCR result for cfr gene is presented in Fig. 3. An amplicon of the expected size was obtained. A fragment of 746 bp was sequenced by Sanger method, then compared with the cfr gene sequence from NCBI database to confirm the existence of cfr gene involved in resistance to linezolid.

Fig. 3. Agarose gel electrophoresis for cfr gene (original photo)

1 – S. hominis 423/ 22633 strain; NC – negative control (with H2O); M – 100 bp DNA Ladder Promega.

By sequencing and comparing the domain V region of 23S rRNA sequence with the sequence of S. aureus 23S rRNA gene (GenBank accession no. X68425.1) we discovered a single nucleotide point mutation in the 2603 position, substituting nucleotide G with T (Fig. 4.).

This mutation was found recently as being involved in linezolid resistance of Staphylococcus capitis strains in a tertiary care hospital in China by Zhou et al.

Fig. 4. The single nucleotide point mutation in the 2603 position in the domain V of the 23S rRNA gene (BioEdit program)

Discussion

CoNS, which can form part of normal skin flora are also a frequent cause of infections in hospital and community-acquired. They are commonly implicated in catheter infections, infectious endocarditis, prosthesis infections and osteoarticular infections, among others. Their treatment with linezolid, especially in ICUs, has considerably increased the consumption of these antibiotic in recent years. As with other families of antibiotics, it has been reported that the increase in their use is related to an increase in the detection of resistant isolates (Kelly et al., 2008; Kolar et al., 2006). The previous administration of linezolid is known to be associated with the development of resistance in CoNS. There are also reports of infection or colonization by linezolid-resistant CoNS in patients with no previous exposure to the antibiotic (Potoski et al., 2006) and of environmental contamination by methicillin-resistant staphylococci with reduced susceptibility to glycopeptides (Perdelli et al., 2008).

The source remain unknown, despite of the isolation of this linezolid-resistant CoNS, because the hospital did not implement screening but for Staphylococcus aureus.

However, this is the first case of linezolid-resistant bacteria received by the Reference Laboratory for Nosocomial Infections and Antimicrobial Resistance in Romania. The rapid identification, the prevention of dissemination along with rational use of antibiotics are important bundles contributing together in preventing the selection of drug-resistant pathogens.

Conclusions

Nowdays, linezolid-resistant Staphylococcus is still sporadic. The prolonged hospital stays, especially in Intensive Care Units (ICUs), frequent interventions, the inadequate use of antibiotics and the difficulty in detecting certain resistance phenotypes/ genotypes may accelerate the dissemination of linezolid resistance Staphylococcus. To preserve the therapeutic efficacy of this reserve antimicrobial, for a longer period of time rational use of linezolid and surveillance of resistance in staphylococci using the most rapid and sensitive methods are recommended.

As far as we know, this is the first report of a linezolid-resistant strain of staphylococci in Romania and the first G2603T mutation in the domain V region of 23S rRNA in CoNS reported in Europe.

Acknowledgements

This study was supported by the National Program of Nosocomial Infections Surveillance coordinated by the National Institute of Public Health, Bucharest, Romania and by the PN…. , coordinated by PhD Monica Straut, SR I.

We would like to thank PhD Mihaela Oprea from the Molecular Epidemiology Laboratory – “Cantacuzino” NIR for critical proofreading.

Conflict of interest

None declared.