EFFECT OF SIRT1 INHIBITION ON MMP2 AND FOXO3 a EXPRESSION IN BREAST CANCER CELLS Hanan Abdelmawgoud Atia, Rehab Refaat El Awady BIOCHEMISTRY… [601448]

1

EFFECT OF SIRT1 INHIBITION ON MMP2 AND
FOXO3 a EXPRESSION IN BREAST CANCER CELLS
Hanan Abdelmawgoud Atia, Rehab Refaat El Awady
BIOCHEMISTRY DEPARTMENT, FACULTY OF PHARMACY
(GIRLS), AL AZHAR UNIVERSITY .

ABSTRACT

Breast cancer is the most common invasive cancer in women
worldwide. Sirtuin 1 (SIRT1) has recently been shown to have
implications in regulating cancer cell growth and apoptosis. SIRT1
regulates Forkhead box O3 a (FOXO3a) by both inhibiting FOXO3 –
induced apoptosis and potentiating the ability of FOXO3a to induce
cell cycle arrest and resist oxidative stress. Matrix metalloproteinase 2
(MMP2) participates in tumor invasion and metastasis by degrading
extracellular m atrix. SIRT1 up regulates MMP2 expression by its
deacetylation activity. This study aimed to investigate the effect of
SIRT1 inhibition on both FOXO3a and MMP2 expression in breast
cancer (MCF -7) cells was assessed. The expression levels of SIRT1,
FOXO3a and MMP2 in the breast tissues were determined by real –
time PCR. After SIRT1 inhibition, protein levels of SIRT1 and
FOXO3a was assessed by Western Blot and levels of MMP2 by
ELISA in MCF -7 cells . The expression levels of SIRT1, FOXO3a and
MMP2 were signifi cantly higher in breast cancer tissues compared to
in benign breast tumour and adjacent normal tissues . SIRT1 inhibition
suppresses MMP2 and FOXO3a expression compared to control
MCF7. Sirtinol (SIRT1 inhibitor) effectively induced inhibition of
MMP2 and FOXO3a expression in MCF -7 cells, indicating the
promising therapeutic strategy of targeting SIRT1 for breast cancer.
Key words: SIRT1, FOXO3a, MMP2, Breast cancer, Sirtinol.

2

INTRODUCTION
Breast cancer is the third most frequent cancer worldwide. It is the
most common malignancy, making up 21% of all new cancer
diagnoses among women (Taylor et al., 2015) . Mortality from breast
cancer is almost caused by invasion and metastasis of carcinomi c cells
to distant organ sites; subsequently, identifying genes involved in
metastasis of breast cancer is of great importance (DeSantis et al.,
2011; Zani and Clary, 2011) .
SIRT1 (Sirtuin 1, silent mating -type information regulation 2
homologue 1), also known as NAD -dependent deacetylase, is a
nuclear enzyme that has a role in deacetylation of histones and several
nonhistone proteins. Acetylation of key cell cycle and apoptosis
regulatory proteins, including p53 and forkhead box O (FOXO),
through stress -induced activation of cellular histone/protein
acetyltransferases, promotes cell death. This effect is counteracted by
sirtuin -mediated deacetylation of these protein targets with subsequent
cell survival under stress (Lin and Fang, 2013).
With regard to t he growth of cancer cells, it has been reported that
SIRT1 regulates cell proliferation, survival, and death, and plays a
pivotal role in tumorigenesis and longevity. In humans, several types
of cancer, including prostate, breast cancer, colon, glioblastom a,
lymphoma and acute myeloid leukemia have been demonstrated to
have a significantly increased expression of SIRT1 (Wu et al., 2012).
Interestingly, Sirts seem to have a dual role in cancer. In fact, while
protecting the organism against tumours by incre asing genomic
stability and limiting cellular replicative lifespan, they can also induce
tumorigenesis by promoting cell survival under stress conditions and
improving the uncontrolled cell division (Taylor et al., 2008) . The
possible explanation of this d ouble face of Sirts in cancer could be
related to their key role in cellular pathways such as cell growth, cell
cycle, genome integrity, and cell death in response to stressor stimuli

3

(Palmirotta et al., 2016).
The effects of SIRT1 on FOXO function are co mplex and vary
depending upon the FOXO target genes. It has been found that SIRT1
increases transcription of FOXO target genes involved in cell survival
under stress, however, it decreases transcription of genes involved in
cell death. Thus, SIRT1 appears to shift the FOXO -dependent
response away from cell death toward stress resistance. This could be
explained by the concept that acetylation/ deacetylation of FOXO
protein may switch target specificity (Nho and Hergert, 2014).
Matrix metalloproteinases (MMPs) are a family of zinc -dependent
endopeptidases that have an important role in promoting cancer cell
invasion through the degradation of extracellular matrix. They have
been found in greater amounts and higher activity in and around
malignant tissues than in normal, benign, or premalignant tissues
(Noel et al., 2008). MMPs can occur in both inactive pro -enzymes
and active enzymes. The mechanism of activation in vivo is still
unknown but may be mediated by proteolytic activity of other MMPs
and/or serine proteases (Radenkovic et al., 2014) .
One of the MMPs implicated in cancer invasion is MMP -2 which also
known as gelatinase A. This MMP is thought to mediate invasion and
metastasis through the degradation of type IV collagen, the main
component of basement membranes which induces angiogenesis
(Köhrmann et al., 2009) . MMP -2 expression and activity are
regula ted by SIRT1 at posttranslational level. It has been found that
the up regulation of MMP -2 expression by SIRT1is mediated by its
deacetylation activity. However, SIRT1 knockdown reduces MMP -2
expression through decreasing its protein stability (Lovaas et al.,
2013) .
The aim of the present study was to investigate SIRT1, FOXO3a and
MMP2 gene expression in breast cancer, benign breast tumour and

4

adjacent normal tissues. Also, to study the correlations of SIRT1,
FOXO3a and MMP2 with clinicopathological and biochemical
parameters. In addition, we aimed to assess the effect of SIRT1
inhibiti on on both FOXO3a and MMP2 gene expression in breast
(MCF -7) human cancer cells.
MATERIALS AND METHODS

Ethical approval: The study was approved by the Institutional Review
Board (IRB) of the National Cancer Institute (NCI), Cairo University
and was conduc ted according to the rules of Helsinki declaration for
human studies. A Written informed consent was obtained from all
patients.
Patients : This study included an overall number of 92 patients
attended at National Cancer Institute, Cairo, Egypt. They were divided
into two groups; the first group contained 60 patients newly diagnosed
as malignant breast cancer while the second group contained 32
patients newly diagnosed as benign breast tumour. The classification
of tumour and its stage were performed according to the international
union against cancer (Tumour –Node –Metastasis) classification. The
breast cancer histopathology was carried out in all cases with tissue
biopsy from tumour cancer tissues and from adjacent normal tissue.
Also, the benign breast tumour histopathology was implemented in all
cases by tissue biopsy of mammary tumour or after surgery.
Furthermore, three tissue cores were ta ken from all breast lesions, one
of them stored in RNA lysis solution at -800C for genetic processing
of SIRT1, FOXO3a and MMP2 genes and other two cores stored
within formalin 10% for histopathological and hormonal receptors
assessment.
Biochemical analy sis: Three ml of peripheral blood sample were
collected for assessment of serum cancer antigen 15.3 (CA 15.3) and

5

serum carcinoembryonic antigen (CEA) following standard laboratory
methods.
Real -time quantitative analysis for SIRT1, FOXO3a and MMP2
gene ex pression: Total RNA was extracted from tissue homogenate
using SV Total RNA Isolation System (Promega, Madison, WI, USA)
according to manufacturer’s instruction. Complementary DNA
(cDNA) was synthesized from 1μg RNA using SuperScript III First –
Strand Synth esis System as described in the manufacturer’s protocol
(#K1621, Fermentas, Waltham, MA, USA). Real -time quantitative
PCR amplification and analysis were performed using an Applied
Biosystem with software version 3.1 (StepOne™, USA). The reaction
contained SYBR Green Master Mix (Applied Biosystems), gene –
specific primer pairs designed with Gene Runner Software (Hasting
Software, Inc., Hasting, NY) from RNA sequences from Gen Bank
(SIRT1: Forward primer 5′-AGAGCCTCACATGCAAGCTCTAG -3′,
Reverse primer 5′-GCCAATCATAAGATGTTGCTGAAC -3,
FOXO3a: Forward primer 5′ CGACTATGCAGTGACAGGTTGTG
3′, Reverse primer 5′ CGACTATGCAGTGACAGGTTGTG 3′,
MMP2: Forward primer 5′ GGCCCTGTCACTCCTGAGAT 3′,
Reverse primer 5′ GGCAT CCAGGTTATCGGGGA 3′, GAPDH:
Forward pri mer 5′ C CAGGTTGGTCTCCTCTGACTT 3′, Reverse
primer 5′ GTTGCTGTAGCCAAATTCGTTGT 5′) . All primer sets
had a calculated annealing temperature of 60°. Quantitative RT -PCR
was performed in a 25 -μl reaction volume consisting of 2X SYBR
Green PCR Master Mix, 900 nM of each primer and 2μl of cDNA.
Amplification conditions were: 2 min at 50°, 10 min at 95° and 40
cycles of denaturation for 15 s and annealing/extension at 60° for 10
min. Data from real -time assays were calculated using the v1·7
Sequence Detection Softwa re from PE Biosystems (Foster City, CA).
All values were normalized to the GAPDH which was used as the
endogenous control (reference gene). Relative quantifications were
calculated using the 2−ΔΔCt method (Pfaffl, 2001).

6

Cultures of human breast cancer (MCF7) cells: Breast (MCF -7)
human cancer cells was obtained from the tissue culture unit of the
Holding Company for Biological Products and Vaccines
(VACSERA), Giza, Egypt and supplied through the American Type
Culture Coll ection (ATCC; Virginia, USA) and were grown in a
sterile 50 cm2 tissue culture flask in complete medium containing
Dulbecco’s modified Eagle’s medium ( DMEM) supplemented with
10% phosphate -buffered saline (PBS) and 1% penicillin –
streptomycin (100 units/mL penicillin and 100 μg/mL streptomycin).
All cells were incubated in a humidified atmosphere incubator
containing 5% CO 2 at 37°C. Cells were cultured to100% confluence.
Cells were passaged using trypsin -EDTA. The cultured MCF7 cells
were divided into 2 grou ps: 1st MCF7 cells as control cells, 2nd
MCF7 cells were treated with sirtinol (SIRT1 inhibitor) which was
purchased from Sigma; dissolved in dimethyl sulfoxide (DMSO) at a
dose 120 μ M for 24 h, then the media were collected and centrifuged
at 10.000 rpm for 20 min, the supernatant was kept frozen at -80°C
till analysis. MCF7 cells were harvested for assessment of protein
expression of SIRT1 and FOXO3a by western blot and for
assessment of MMP2 by ELIZA .
Western Blot analysis of SIRT1 and FOXO3a (usingV3 Western
Workflow™ Complete System, Bio -Rad® Hercules, CA, USA): Cells
were washed with ice -cold PBS, trypsinized, and collected by
centrifugation. Protein were extracted from c ell lysates using ice -cold
radioimmunoprecipitation assay (RIPA) lysis buffer PL005 was
provided by Bio BASIC INC (Marhham Ontario L3R 8T4 Canada)
(50mM Tris HCL, 150 mM NaCl, 1% Triton X -100, 1% sodium
deoxycholate, 0.1% SDS (sodium dodecyl sulphte) supplemented with
phosphatase and protease inhibitors, then centrifugation at 12,00 0 rpm
for 20 minutes at 4°C . The protein concentration for each sample was
determined using Bradford assay. Equal amounts of protein (20 -30 µg
of total protein) and 2X Laemmli buffer were heated at 70°C for 5 -10

7

minutes and separated by SDS/polyacrylamide gel electrophoresis
(10% acrylamide gel) using a Bio -Rad Mini -Protein II system. The
protein was transferred to polyvinylidene difluoride (PVDF)
membranes (Pierce, Rockford, IL, USA) with a Bio -Rad Trans -Blot
system (TGX Stain -Free™ FastCast™ Acrylamide Ki t hich was
provided by Bio -Rad Laboratories, TNC, USA) . After transfer, the
membranes were washed with Tris Buffer Saline (TBS) and blocked
for 1 h at room temperature with 5% (w/v) skimmed milk powder in
TBS. The manufacturer’s instructions were followed for the primary
antibody reactions. Following blocking, the blots were developed
using antibodies for SIRT1, FOXO3a and β-actin supplied by
(Thermoscientific, Rockford, Illinois, USA) incubated overnight at pH
7.6 at 4°C with gentle shaking. After washing, peroxidase -labeled
secondary antibodies were added, and the membranes were incubated
at 37°C for 1h then washed with TBS 5 times for 5 min.
Chemiluminescence substrate (Clarity Western ECL Substrate BIO –
RAD, USA) was applied to the blot according to manuf acturer’s
recommendation. Band intensity was analyzed by ChemiDocTM
imaging system with Image LabTM software version 5.1 (Bio -Rad
Laboratories Inc., Hercules, CA, USA). The results were expressed as
arbitrary units after normalization for β-actin protein ex pression.
Assessment of MMP -2: (using ELISA Kit Catalog No:
MBS2506130): Cell culture supernatant was centrifuged for 20
minutes to remove insoluble impurity and cell debris at 1000×g at 2 –
8°C. The clear supernatant was used for assessment of MMP2
immediately.
Statistical analysis: Analysis of more than two variables was done by
One-Way ANOVA followed by T ukey’s comparison test. Unpaired t
test was used for comparison of two quantitative variables. Simple
linear correlation (Pearson’s correlation) was also carried out. Data
are expressed as mean ±SD using Graph pad prism version 5.0. The
statistical significance was set as P < 0.05 .

8

RESULTS
Patient features: The study included 60 patients with primary
malignant breast cancer with mean age of 52.18±12.17 years and 32
patients with benign breast tumour with mean age of 45.55±10.14
years. The majority of the patients were invasive duct carcinoma (N=
39, 65 %), 15% of patients with invasive duct carcinoma with lobular
features and 20% with other types of breast cancer. Most of patients
were moderately differentiated in histologic grade ( grade II, N= 46,
76.7%), 8.3% of patients in grade I and 15% in grade III. Large
number of patients had no lymph node metastasis (N=35, 58.33%).
Most of the cases were positive ER (N=47, 78.33%), PR (N=45, 75%)
and negative HER2 (N=42, 70%). The percentage of tumours at stage
2 and 3 at the time of diagnosis was 65% and 35%, respectiv ely.
Histology of benign breast tumour showed that 50% (N=16) of
patients were fibroadenoma, 25% (N=8) were fibrocystic mastopathy,
9.37% (N=3) were spindle cell tumour, 9.37% (N=3) were
granulomatous mastitis, 3.13% (N=1) were fat necrosis and 3.13%
(N=1) were fibro -epithelial tumour.
Serum levels of tumour markers: The levels of CA 15.3 and CEA
were significantly higher in malignant breast cancer group
(96.7 ±13.04, 12.2 ±3.39 , respectively ) compared to benign tumour
group (16.76 ±4.9, 2.29±0.7 , respectively ) at P <0.001 .
Tissue levels of SIRT1, MMP2 and FOXO3a: It has been shown that
SIRT1, MMP2 and FOXO3a were significantly overexpressed in
breast cancer tissues ( 10.73 ±1.32, 13.18 ±1.49, 14.21 ±2.06 ,
respectively ) compared to in benign breast tumour ( 2.47 ±1.15, 2.54
±0.6, 4.46 ±0.49 , respectively ) and adjacent normal tissues ( 1.012
±0.044, 1.015 ±0.033, 1.00 ±0.013 , respectively ) at P <0.0001 (Figure
1).

9

Figure 1: Expression of SIRT1, MMP2 and FOXO3a in breast tissues of the studied
groups.
Parameters w ere presented on the charts as means ±SD. SIRT1: sirtuin 1, FOXO3a:
forkhead box O3 a, MMP2: matrix metalloproteinase 2. a: significant from normal
tissues, b: significant from benign tissues.
Effect of SIRT1 inhibition on MMP2 and FOXO3a expression: In
order to study the regulation of SIRT1 on MMP2 and FOXO3a
expression, we treated breast cancer cell line (MCF7) with sirtinol
(SIRT1 inhibitor), and found that SIRT1 inhibition suppresses
FOXO3a expression ( 0.27 ±0.029) and decrease MMP2 level ( 4.22
±0.334) compared to control MCF7 ( 1.03 ±0.028, 16.23 ±1.01 ,
respectively) at P <0.0001 as shown in Figure 2.
Pearson’s correlation analysis: There was a significant inverse
correlation between MMP2, FOXO3a expression with age (r: – 0.77, P
<0.0001 and r: – 05, P: 0.01 , respectively ) and with CEA (r: -0.45, P:
0.02 and r: -0.65, P: 0.001, respectively ). SIRT1 was associated
directly with tumour grade and stage (r: 0.55, P: 0.005 and r: 0.484 , P:
0.017, respectively ). Also, there was a significant direct correlation
between MMP2, FOXO3a expression and tumour stage (r: 0.517, P:
0.01 and r: 0.435, P: 0.034, respectively) . There was a significant
inverse correlation between SIRT1, FOXO3a expression with CA15.3
(r: -0.44, P: 0.03 and r: -0.6, P: 0.002 , respectively). SIRT1, MMP2 and

10

FOXO3a were associated directly with lymph node status ( r: 0.67, P:
0.0002, r: 0.71, P: 0.0001 and r: 0.51, P: 0.01, respectively). Regarding
correlation between SIRT1, MMP2 and FOXO3a expression, there
was a significant direct correlation between them (P <0.0001).

Sirt 1

Foxo3a

Beta actin

MCF7 Sirtinol
Figure 2: Effect of sirtinol on SIRT1, FOXO3a expression (A) and on MMP2
protein levels (B).
Parameters were presented on the charts as means ±SD. SIRT1: sirtuin 1, FOXO3a:
forkhead box O3 a, MMP2: matrix metalloproteinase 2.

11

DISCUSSION
Breast cancer is one of the most frequent cancers and it is the leading
cause of death related to cancer among women worldwide. Death
from breast cancer results from distance metastasis rather than
primary cancer (Jemal et al., 2011).
It has been suggested that SIRT1 has a promoting function in tumor
development and progression through the deacetylatio n of some key
cell cycle and apoptosis regulatory proteins like p53 and FOXO
leading to suppression of their function (Lin and Fang, 2013).
The present study showed that there was an extremely high frequency
of overexpressed SIRT1 in breast malignant tumour tissues compared
to their paired normal tissues and to benign tumour tissues. The
expression of SIRT1 in breast cancer tissues is controversial. In
accordance to our results, Derr et al. (2014), Kuo et al. (2013) and
Sung et al. (2010) demonstrated an overexpression of the SIRT1 in
breast cancer tissue than in normal tissue. In addition, several reports
have demonstrated that overexpression of SITR1 is not only in breast
cancer tissue but also in other cancer tissue, including pr ostate cancer
(Lovaas et al., 2013), lung cancer (Grbesa et al., 2015 & Li et al.,
2015), gastric cancer (Cha et al., 2009), and hepatocellular carcinoma
(Choi et al., 2011).
In contrast to our results, some researchers reported that SIRT1 has an
antitumor potential. Cao et al. (2014) and Wang et al. (2008) found a
significant lower expression of SIRT1 in breast cancer tissue than in
normal tissue. Thus, SIRT1 may act as a tumour suppressor through
its role in DNA damage repair and maintaining genome integrity. The
definite role of SIRT1 is not clear now.
Regarding MMP2 and FOXO3a , our results revealed a significant
overexpression in breast cancer ti ssues compared to in benign breast

12

tumour and adjacent normal tissues. In agreement with these results,
other studies by Mahmood et al. (2015), Radenkovic et al. (2014),
Sil et al. (2015) and Sullu et al. (2011) found that MMP2 expression
was increased in breast cancer tissues as compared to that of benign
tumor and adjacent normal tissues. On the other hand , Jiang et al.
(2013) found that only 37% of breast cancer tissue samples expressing
high level of FOXO3a. In addition, Chen et al. (2010) and Lam et al.
(2012) revealed that FOXO3a has been shown to be deregulated in
breast cancer.
In the present study, SIRT1 was associated directly with tumour grade,
stage and lymph node status. These finding came in agreement with
Wu et al. (2012) who found that the expression of SIRT1 was
significantly correlated with tumor stage and lymph node status.
In this study, both MMP2 and FOXO3a were significantly correlated
with tumor stage and lymph node status which came in accordance
with other studies that found a significant correlation between MMP2
and both tumor stage and lymph node metastasis (Mahmood et al.,
2015 & Radenk ovic et al., 2014). In addition, Jiang et al, found that
FOXO3a expression was strongly associated with axillary lymph node
status and TNM stage (Jiang et al., 2013). Furthermore, it has been
revealed that nuclear FOXO3a was associated with lymph node
meta stasis and poor survival in invasive ductal breast carcinoma
(Chen et al., 2010).
Regarding correlation between SIRT1, MMP2 and FOXO3a
expression, there was a significant direct correlation between them.
It is the first time to study the effect of SIRT1 i nhibition on both
MMP2 and FOXO3a in breast cancer. In order to study the effect of
SIRT1 on MMP2 and FOXO3a expression, we treated breast cancer
cell line (MCF7) with sirtinol (SIRT1 inhibitor), and found that SIRT1
inhibition suppresses MMP2 and FOXO3a e xpression compared to

13

control MCF7. These finding came in agreement with Lovaas et al.
(2013) who found that SIRT1 inhibition with sirtinol suppresses
MMP2 expression in both LNCaP and PC3 prostate cancer cells. Kuo
et al. (2013) revealed that the cell via bility was reduced by sirtinol in
a time – and dose -dependent manner in MCF -7. In addition, Grbesa et
al. (2015) found that SIRT1 inhibition via siRNA inhibits cell growth
in lung cancer cell lines. These results suggest an association of
SIRT1 expression w ith breast cancer development and that SIRT1
plays a role in cancer cell growth.
Regarding the effect of SIRT1 on MMP2, SIRT1 has been reported as
a positive regulator of MMP2 activity by promoting its expression,
stability and activity (Gong et al., 2014) . MMP2 has been found to
have important role in intravasation and metastasis sustaining
neovasculature not only by induction of angiogenic factors like
vascular endothelial growth factor, but also through proteolytic
remodeling of the tumor matrix (Deryugi na and Quigley, 2015) .
Taken together, SIRT1 inhibition decreases MMP2 expression and as
a result can decrease cancer invasion. Thus, SIRT1 inhibition may be
a therapeutic target in breast cancer.
Regarding the effect of SIRT1 on FOXO3a, it has been reveal ed that
SIRT1 regulates FOXO3 by both inhibiting FOXO3 -induced
apoptosis and potentiating the ability of FOXO3 to resist oxidative
stress (Nogueiras et al ., 2012) . The effects of SIRT1 on FOXO vary
depending on the FOXO target genes. SIRT1 promotes the expression
of FOXO target genes involved in stress resistance, but on the other
hand decreases the transcription of genes involved in apoptosis
leading to shift the F OXOs -dependent response away from apoptosis
and toward stress resistance. In addition, it has been found that the
inhibition of SIRT1 enhances the apoptosis elicited by oxidative
stress. Thus, SIRT1 inhibition may contribute to the treatment of

14

cancer pati ents in combination with reactive oxygen species (ROS) –
generating anti -cancer drugs (Hori et al., 2013) .
In conclusion : SIRT1 inhibition decreased MMP2 and FOXO3a
expression in MCF -7 cells, so it may decrease cancer invasion and
increase tumour cell apopto sis, indicating the promising therapeutic
strategy of targeting SIRT1 for breast cancer.

REFERENCES
Cao YW, Li WQ, Wan GX, Li YX, Du XM, Li YC, Li F (2014):
Correlation and prognostic value of SIRT1 and Notch1 signaling in
breast cancer. J Exp Clin Cancer Res. ; 33(1):97.
http://www.jeccr.com/content/33/1/97 .
Cha EJ, Noh SJ, Kwon KS, Kim CY, Park BH, Park HS, et al.
(2009): Expression of DBC1 and SIRT1 is associated with poor
prognosis of gastric carcinoma. Clin Cancer Res. ; 15(13):4453 –4459.
Chen J, Gomes AR, Monteiro LJ, Wong SY, Wu LH, Ng TT, et al.
(2010): Constitutively nuclear FOXO3a localization predicts poor
survival and promotes Akt phosphorylation in breast cancer. PloS one ;
5(8):e12293.
Choi HN, Bae JS, Jamiyandorj U, Noh SJ, Park HS, Jang KY, et
al. (2011): Expression and role of SIRT1 in hepatocellular carcinoma.
Oncol Rep. ; 26(2): 503 –510.
Derr RS , van Hoesel AQ , Benard A , Goossens -Beumer IJ, Sajet A,
Dekker -Ensink NG, et al. (2014): High nuclear expression levels of
histone -modifying enzymes LSD1, H DAC2 and SIRT1 in tumor cells
correlate with decreased survival and increased relapse in breast
cancer patients. BMC Cancer ; 14:604. doi: 10.1186/1471 -2407 -14-
604.
Deryugina EI a nd Quigley JP (2015): Tumor Angiogenesis: MMP –
Mediated Induction of Intravasation – and Metastasis -Sustaining
Neovasculature. Matrix Biol. ; 44-46:94 -112.

15

DeSantis C, Siegel R, Bandi P, Jemal A (2011): Breast cancer
statistics, 2011. CA Cancer J Clin. ; 61(6):409 –418.
Gong Y, Chippada -Venkata UD, Oh WK (2014): Roles of Matrix
Metalloproteinases and Their Natural Inhibitors in Prostate Cancer
Progression. Cancers ; 6 (3): 1298 -1327.
Grbesa I, Pajares MJ, Martínez -Terroba E, Agorreta J, Mikecin
AM, Larráyoz M, et al. (2015): Expression of sirtuin 1 and 2 is
associated with poor prognosis in non -small cell lung cancer
patients. PloS one; 10(4): e0124670.
Hori YS, Kuno A, Hosoda R, Horio Y (2013): Regulation of
FOXOs and p53 by SIRT1 modulators under oxidativ e stress. PloS
one; 8(9): e73875.
Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D
(2011): Global cancer statistics. CA Cancer J Clin. ; 61(2):69 –90.
Jiang Y, Zou L, Lu WQ, Zhang Y, Shen AG (2013): Foxo3a
Expression Is a Prognostic Marker in Breast Cancer. PloS one ; 8(8):
e70746.
Köhrmann A , Kammerer U , Kapp M , Dietl J , Anacker J (2009):
Express ion of matrix metalloproteinases (MMPs) in primary human
breast cancer and breast cancer cell lines: New findings and review of
the literature. BMC Cancer ; 9:188. doi: 10.1186/1471 -2407 -9-188.
Kuo SJ, Lin HY, Chien SY, Chen DR (2013): SIRT1 suppresses
breast cancer growth through downregulation of the Bcl -2 protein.
Oncol Rep. ; 30(1): 125 -130.
Lam M, Carmichael AR, Griffiths HR (2012): An aqueous extract
of Fagonia cretica induces DNA damage, cell cycle arrest and
apoptosis in breast cancer cells via FOXO3a and p53 expression. PloS
one; 7 (6): e40152.
Li C, Wang L, Zheng L, Zhan X, Xu B, Jiang J, Wu C (2015):
SIRT1 expression is associated with poor prognosis of lung
adenocarcinoma. Onco Targets Ther. ; 8: 977 –984.
Lin Z and Fang D (2013): The Roles of SIRT1 in Cancer. Genes
Cancer ; 4(3-4): 97 -104.

16

Lovaas JD, Zhu L, Chiao CY, Byles V, Faller DV, Dai Y (2013):
SIRT1 Enhances Matrix Metalloproteinase -2 Expression and Tumor
Cell Invasion in Prostate Cancer Cells. Prostate ; 73(5): 522-530.
Mahmood NA, Fakhoury RM, Yaseen NY, Moustafa ME (2015):
Matrix Metalloproteinases MMP2 and MMP9 Expression in Stages II –
III Breast Cancer in Iraqi Women. J Med Bio Sci Res. ; 1 (3): 30 -37.
Nho RS, Hergert P (2014): FoxO3a and disease progression. World J
Biol Chem. ; 5(3): 346 -354.
Noel A, Jost M, Maquoi E (2008): Matrix metalloproteinases at
cancer tumor -host interface. Semin Cell Dev Biol. ; 19(1):52 –60.
Nogueiras R, Habegger KM, Chaudhary N, Finan B, Banks AS,
Dietrich MO, et al. (2012): Sirtuin 1 and Sirtuin 3: physiological
modulators of metabolism. Physiol Rev. ; 92(3):1479 -514.
Palmirotta R, Cives M, Della -Morte D, Capuani B, Lauro D,
Guadagni F, Silvestris F (2016): Sirtuins and Cancer: Role in the
Epithelial -Mesenchymal Transition. Oxidative Medicine and Cellular
Longevity ; 2016. doi:10.1155/2016/3031459 .
Pfaffl MW (2001): A new mathematical model for relative
quantific ation in real -time RT -PCR. Nucleic Acids Res. ; 29(9):e45.
Radenkovic S, Konjevic G , Jurisic V , Karadzic K , Nikitovic M ,
Gopcevic K (2014): Values of MMP -2 and MMP -9 in tumor tissue of
basal -like breast cancer patients. Cell Biochem Biophys. ; 68(1):143 –
152.
Sil H, Moulik S, Singha I, Mandal SS, Biswas J, Chatterjee A
(2015): Activation of Matrix Metalloproteinase 2(MMP -2) in Breast
Cancer Progression. J Tumor ; 3(1): 292 -299.
Sullu Y , Demirag GG , Yildirim A , Karagoz F , Kandemir B
(2011): Matrix metalloproteinase -2 (MMP -2) and MMP -9 expression
in invasive ductal carcinoma of the breast. Pathol Res Pract. ;
207(12):747 -753.
Sung JY, Kim R, Kim JE, Lee J (2010): Balance between SIRT1
and DBC1 expression is lost in breast cancer. Cancer Sci. ;
101(7):1738 –1744.

17

Taylor DM, Maxwell MM, Luthi -Carter R, Kazantsev AG (2008):
Biological and potential therapeutic roles of sirtuin deacetylases. Cell
Mol Life Sci. ; 65 (24): 4000 –4018.
Taylor S, Lam M, Pararasa C, Brown JE, Carmichael AR,
Griffiths HR (2015): Evaluating the evidence for targeting FOXO3a
in breast cancer: a systematic review. Cancer Cell Int .; 15 (1):1. doi:
10.1186/s12935 -015-0156 -6.
Wang RH, Sengupta K, Li C, Kim HS, Cao L, Xiao C, et al.
(2008): Impaired DNA damage response, genome instability, and
tumorigenesis in SIRT1 mutant mice. Cancer Cell ; 14(4): 312 -323.
Wu M, Wei W, Xiao X, Guo J, Xie X, Li L, et al. (2012):
Expression of SIRT1 is associated with lymph node metastasis and
poor prognosis in both operable triple -negative and non -triple –
negative breast cancer. Med Oncol. ; 29(5):3240 –3249.
Zani S and Clary BM (2011): Role for hepatic metastasectomy in
stage IV melanoma and breast cancer: re -establishing the surgical
modality. Oncology ; 25(12): 1158 –1164.

18

الملخص العربى
تأثير تثبيط السيرتوين 1 على التعبيرالجيني لكال منالماتريكس ميتالوبروتينيز 2
والفوكسو 3a في خاليا سرطانالثدي

حنان عبدالموجود عطية- رحاب رفعت العوضي
قسم الكيمياء الحيوية – كلية الصيدلة (بنات) – جامعة األزهر
سرطان الثدي هو السرطان األكثر شيوعا لدى النساء في جميع أنحاء العالم .وقد تبين مؤخرا
أن السيرتوين 1 له دور في تنظيم نمو الخاليا السرطانية وموت الخاليا المبرمج .ينظم
سيرتوين 1 الفوكسو3a عن طريق تثبيطدور الفوكسو3a في موت الخاليا المبرمج وتعزيز
قدرته في مقاومة اإلجهاد التأكسدي .الماتريكس ميتالوبروتينيز 2 يشارك فيانتشار الورم
.ينظم سيرتوين 1 الماتزيكس ميتالوبروتيناز 2 عن طريق إزالة مجموعة األسيتيل. هدفت
هذه الدراسة إلى التعرف على تأثير تثبيط سيرتوين 1 على التعبيرالجيني لكال منالماتريكس
ميتالوبروتينيز 2 والفوكسو3a فيخاليا سرطان الثدي .أظهرت مستويات التعبيرالجيني
لكال من السيرتوين 1 والماتريكس ميتالوبروتينيز 2 والفوكسو3a زيادة ذات داللة
إحصائية في أنسجة سرطان الثدي الخبيث مقارنة مع ورم الثدي الحميد واألنسجة الطبيعية
المجاورة. بعد تثبيط السيرتوين 1 عن طريق السيرتين ول ، أظهرت مستويات البروتين لكال
من السيرتوين 1 والماتريكس ميتالوبروتينيز 2 والفوكسو3a نقصا ذا داللة إحصائية في
خاليا سرطان الثدي (MCF7) مقارنةبالخاليا الضابطة ، مما يدل على استراتيجية عالجية
واعدة الستهداف السيرتوين 1 لسرطان الثدي.