Dna Based Methods For Food Components Identificationdocx

=== Dna based methods for food components identification ===

DNA BASED METHODS FOR FOOD COMPONENTS IDENTIFICATION

Boldura O.M.1, Popescu S.1, Lazar A.1, Balta C.1

1Banat University of Agricultural Sciences and Veterinary Medicine, Timisoara, Romania

Abstract

The aim of the current study was to develop a strategy for the detection of the animal species present in different food products, based on their DNA, which is a stable molecule both in raw and in processed food.

Key words: meat products; multiplex PCR; species identification

Introduction

In the last period, the information regarding food composition is of great importance, the incorrect labelling representing a commercial fraud considering the consumer acquisition. Therefore it is necessary to develop specialized analytical methods to control the ingredients declared on the labels.

One of the most important ingredient in food products is the meat, thus the identification of species content is performed in many countries for a variety of reasons including economic, ethnic and safety. Such identification may be designed to prevent the substitution of meat destined for human consumption with that of unsuitable or inferior species, or may be of importance in various religious communities where consumption of a particular species is prohibited (Rodríguez et al., 2004; Fumière et al., 2009)

Conventional methods used to determine the origin of the animal species in food products are based on electrophoresis and immunochemical analysis of protein and the techniques of liquid chromatography. The electrophoresis and immunochemical methods cannot distinguish between close species, and are not suited for complex food matrix. Using the chromatographic methods it is possible to point out the differences between the fatty acids, but they are very laborious techniques (Ansfield et al., 2000).

Species identification based on the protein analysis, is a specific and sensitive method but it is not suitable because there is a great risk of cross reactions for closely related species. Another disadvantage is the difficulty of specie detection for the food products which were heat treated.

Recently, the techniques based on DNA analysis, as polymerisation chain reaction (PCR) and DNA hybridisation were used for the identification of the animal species in food products. The nucleic acids, present in foods are without nutritional value, but they are characteristic for specific biological compounds found in complex products. Considering that the DNA is a stable molecule, the processed foods can be analyzed based on DNA analysis.

Therefore DNA analysis is a very sensitive method which can be used even if the meat products were autoclaved. The methods based on DNA hybridisation are time consuming and often their sensitivity was not suitable. Nowadays, the methods based on PCR reaction are of great importance having a large area of using due to its high sensitivity, its specificity and rapidity

In general there are two approaches for species identification: the using of primers specie specific or amplification of a gene present in all of the animal species and the identification of a specie specific sequence based on restriction fragment length polymorphism.

The genes with high copy number are used as target sequences to ensure investigation sensitivity. These genes include ribosomal genes (ADNr 5s, 12s and 18s) or genes from the mithocondrial DNA. It is consider that the presence of 1% of an animal species in a mixed meat product could be easily verified (Chikuni et al., 1990). Therefore, these assays can be useful for the accurate identification of animal species present in meat products, avoiding mislabelling or fraudulent species substitution in meat mixture.

Another ingredient usually added in food products is the soybean flour. For the identification of soybean DNA, primers which amplify a fragment of the lectin gene, specific to this specie were used (Meyer et al., 1996).

A high quantity of the soybean flour used in the food and feed industry is imported in European Union and it is genetically modified. For this reason, in this work we tried to identify the GM (genetically modification) in complex food products. For the GM detection the primers were designed for the nopaline syntase terminator (T-nos) derived from Agrobacterium tumefaciens, the terminal sequence of the GM-soybean construct (Lipp et al., 2001).

Material and methods

Controls

Samples of raw meat from different species of land animal origin were used as controls for animal species identification. Certified reference materials (CRM) – Roundup Ready™ soybean 1% produced by the The Institute for Reference Materials and Measurements (IRMM) was used as controls for GMO.

Samples

Six types of industrial meat products which are salami (4 samples) and sausage (2 samples) were collected from different companies and their labelled content was registered. The samples were stored at -20°C until the extraction of the DNA in order to prevent the enzymatic degradation of DNA.

DNA extraction

Genomic DNA was extracted from each sample using the CTAB method.

100 mg dried ground material was mixed with 300 μl sterile distillated water. 700 μl CTAB buffer (CTAB -20g/l; NaCl- 1,4 M; Tris-HCl – 0,1 M; Na2EDTA- 20 mM, pH 8) was added together with 20 μl RNase solution (10 mg/ml) and the mixture was incubated at 65 °C for 30 min. The samples were centrifuged at 12,000×g for 10 min and the supernatant was transferred to a tube with 500 μl chloroform, vortexed and centrifuged at 12,000 ×g for 15 min. The upper layer was transferred to a new tube and 2 volumes of CTAB precipitation solution (CTAB – 5g/l; NaCl – 0,04M) were added. The samples were incubated at room temperature for 60 min and centrifuged at 12,000×g for 5 min. The pellet was dissolved in 350 μl NaCl 1.2M and 350 μl cloroform was added. The samples were mixed by vortex and centrifuged at 12,000×g for 10 min. The upper layer was precipitated with 0.6 volumes of isopropanol, incubated at room temperature for 20 min and centrifuged at 12,000 ×g for 10 min. The pellet was washed in 70% ethanol, vacuum dried and re-suspended in 100 μl sterile ultrapure water.

DNA amplification

Four sets of primers designed from different regions of mitochondrial DNA (12S rRNA, tRNA Val and 16S rRNA) according to Dalmasso et al. (2004) were used for animal species identification.

The species included in the ruminant screening were Bos taurus, Capra hircus, Ovis aries. The primers were designed in the mitochondrial region 16SRNA and they generated amplification sequences of 104 bp length. The specific ruminant primers had the following sequences: F-5’GAA AGGACAGAAATA AGG 3’, R-5’GCCTAGA3’.

The pork screening included only one specie Sus scrofa and the primers were designed for the mithocondrial region 12S rRNA-tRNA Val and they generated amplification sequences of 290 bp length. The primers had the following sequences F 5’AAGAATATC A3’, R 5’ACATGGGATGGT3’.

The species included in the fish screening were Sardinops melanostictus, Sardinella hualiensis, Pagrus major, Tracurus japonicas. The primers were designed for the mitochondrial region 12S rRNA and the amplified fragment has a 224 bp length. The primers sequence was as follows: F-5’TAAGAGCGGTAATC A3’, R- 5’GTGG GGTATATCCCAG 3’

The chicken screening included Gallus gallus, Meleagris meleagridis and the primers were designed for the mitochondrial region 12S rRNA The sequences are F- 5’ TGA GAA GCAAC3’, R- 5’ CTGTT 3’ and they generated amplification sequences of 183 bp length.

For the simultaneous detection of each species, one step multiplex PCR was developed using each of the primer sets previously designed for the simplex PCR. The same master mix as described for simplex PCR was used, primers concentrations being as follows: 20, 20, 12.5 and 10 pmol of beef, pork, fish and poultry primers

For the detection of animal species the PCR amplification was performed in a final volume of 25 μl using Go Taq Green Master Mix PCR kit from Promega, 20 pmol of primers and DNA template. The amplification program follows the steps: denaturation 94oC, 10 min, 35 cycles: denaturation 94oC, 30 sec, primer annealing 60oC, 1 min, DNA synthesis 72oC, 1 min and the final extension 72oC, 5 min.

Amplicons were separated by 3% agarose gel electrophoresis.

For soybean detection the primers were designed for the lectin gene, with the following sequences: GMO3: 5’GCCCTCTACTCCACCCCCATCC3’ and GMO4: 5’GCCCATCTGCAA GCCTTTTTGTG3’ and the amplified fragment was 118 bp.

Primers HA-nos118-f and HA-nos118-r were used for the detection of the nos terminator, present in the Roundup Ready soybean with the following sequences: nos-f: GCATGA CGTT ATTTATGAGATGGG and nos-r: GACACCGCGCGCGATAATTTAT CC and the length of the amplified fragment was 118 bp. The amplification program was as follows: denaturation 95°C – 3 min; 40 cycles: denaturation 95°C -25 sec; primer annealing 62°C – 30 sec, DNA synthesis 72°C – 45 sec; final extension 72°C – 7 min.

The PCR amplifications was performed in a final volume of 25 μl using Go Taq Green Master Mix PCR kit from Promega, 12.5 pmol pmol from each primers and DNA template The amplification program was as follows: denaturation 95°C – 3 min; 40 cycles: denaturation 95°C -30 sec; primer annealing 63°C – 30 sec, DNA synthesis 72°C – 30 sec; final extension 72°C – 3 min. Amplicons were separated by 2% agarose gel electrophoresis.

Results and discussions

The investigations started with the food products grinding followed by the DNA extraction. The DNA samples were analyzed with the specific primers for each animal specie. After the target sequence amplification the PCR products were separated through agarose gel electrophoresis.

In Figure 1 the amplification with the ruminant primers (A), pork (B), poultry (C) and fish (D) are shown. For each amplification specific positive controls were used: ruminant meat (A), pork meat (B), poultry meat (C) and fish (D).

As shown in Figure 1 A, none of the samples amplified with primers specific to ruminants has not given positive results, indicating that the studied samples are not derived from ruminant species.

In Figure 1B, it was pointed out that all of the analyzed samples (13, 14, 15, 16, 17 and 18) had a common amplified fragment with the same length as the positive control – pork meat, confirming that the DNA extracted from the food samples and not from a contaminant source.

When the samples were analyzed with the poultry specific primers it turned out that all of the food samples contained chicken meat, because the amplified fragment had the same size as the positive control (Figure 1, C).

The fish specific primers amplified only the fish flours samples (Figure 1, D).

Figure 1. The amplifications of the food product DNA, with the primers specific for ruminant (A), pork (B), poultry (C) and fish (D)

Lanes 1, 13, 25, 37– salami sample, lanes 2, 14, 26, 38 – salami sample 2, lanes 3, 15, 27, 39 – salami sample 3, lanes 4,16, 28, 40- salami sample 4, lanes 5, 17, 29, 41 – sausage 1,lanes 6, 18 , 30, 41, 42- sausage 2, lanes 7, 19, 31, 43 – fish flour 1, lanes 8, 20, 32, 44- fish flour 2, lanes 9, 21, 33, 45- EB- extractin blank, lanes 10, 22, 34, 46-NDT- negative DNA control (soybean DNA), lanes 11, 23, 35, 47 -PDT- pozitive DNA control, lanes 12, 24, 36, 48-NTC- non template control

To decrease the time and the reagent consumption a multiplex PCR reaction was performed, with all of the specified primers (Figure 2).

Figure 2. The amplifications of the food product DNA, with the primers specific for ruminant, pork, poultry and fish in a multiplex reaction

Lane 1 – salami sample 1, lane 2 – salami sample 2, lane 3- salami sample 3, lane 4 – salami sample 4, lane 5– sausage 1, lane 6 – sausage 2, lane 7 – fish flour 1, lane 8 – fish flour 2, lane 9- molecular markers, lane 10- positive DNA template (mix of ruminant, pork, poultry and fish meat)

Analyzing the gel it turned out that all of the positive samples identified by simplex PCR reactions were positive in the multiplex reaction too. Therefore, the applicability of the assay to commercial meat products has been demonstrated.

Further on, the amplification with the primers specific for soybean and GM (genetically modification) were done (Figure 3).

Analysing the gel it turned out that all of the food products contained soybean. The following samples: salami 3 and 4, sausage 1 and 2 had a small concentration of GM soybean, even they were not labelled according to EU legislation.

Fig 3. The amplifications of the food product DNA, with the primers specific for ruminant, pork, poultry and fish in a multiplex reaction

Lanes 1, 14 – salami sample 1, lanes 2, 15 – salami sample 2, lanes 3, 16- salami sample 3, lanes 4,17 – salami sample 4, lanes 5,18– sausage 1, lanes 6,19 – sausage 2, lanes 7,19 – fish flour 1, lane 8,20 – fish flour 2, lanes 9, 21- EB- extractin blank, lanes 10, 22 -NDT- negative DNA control, lanes 11, 23 -PDT- pozitive DNA control, lanes 12, 24 -NTC- non template control, lanes; 13,25 PCR marker

The results obtained following all of the amplifications, compared to the labeled components are listed in Table 1. The results were confirmed by the multiplex reaction, when all of the animal species were identified in a single amplification reaction.

Table 1 Results of the identification assay

Conclusions

This work pointed out the mislabelling of the food products. All of the analyzed samples had more ingredients compared to the labelled information.

It turned out that the PCR method is very sensitive and reliable for complex food ingredient identification which could be developed as a multiplex reaction. Thus, the method is precise, fast with low costs which can be used without a special infrastructure.

The test could be useful and applied by researchers and quality control laboratories to check and control of food products.

References

Ansfield M., Reaney S.D. & Jackman R., 2000. Performance assessment and validation of a sensitive immunoassay for detection of ruminant and porcine heat stable proteins in compound animal feedstuffs. Food Agric. Immunol., 12, 285-297.

Chikuni, K., Ozutsumi, K., Koishikawa, T. and Kato, S. 1990. Species identification of cooked meats by DNA hybridization assay. Meat Science, 27: 119-128.

Dalmasso, A., Fontanella, E., Piatti, P., Civera, T., Rosati S., Bottero, M.T., 2004. A multiplex PCR assay for the identification of animal species in feedstuffs, Molecular and Cellular Probes 18, 81–87.

Fumière O., Veys P., Boix A., von Holst C., Baeten V., Berben G., 2009. Methods of detection, species identification and quantification of processed animal proteins in feedingstuffs, Biotechnol. Agron. Soc. Environ. 13 (S), 59-70

Lipp M., Bluth A., Eyquem F., Kruse L., Van den Eede G., Schimmel H., Anklam E., 2001. Validation of a method based on polymerase chain reaction for the detection of genetically modified organisms in various processed foodstuffs, Eur Food Res Technol., 212 :497–504

Meyer, R., Höfelein, C., Lüthy, J. and Candrian, U. 1995. Polymerase Chain Reaction-restriction fragment length polymorphism analysis: a simple method for species identification in food. Journal of AOAC International 78: 1542-1551

Meyer, R., Chardonnens, F., Hubner, P., Luthy, J. 1996. Polymerase chain reaction (PCR) in the quality and safety assurance of food: Detection of soya in processed meat products. Z. Lebensm. Unters. Forsch., 203: 339-344.

Rodríguez, M.A., García, T., González, I., Asensio, L., Hernández, P.E. and Martín R. 2004. PCR identification of beef, sheep, goat, and pork in raw and heat-treated meat mixtures. Journal of Food Protection 67: 172-177.