Original article [602868]

Original article
Mechanistic insights into the effects of quercetin and/or GLP-1
analogue liraglutide on high-fat diet/streptozotocin-induced type 2
diabetes in rats
Hanaa H. Gaballaha,*, Soha S. Zakariaa, Shorouk E. Mwafyb, Nahid M. Tahoonc,
Abla M. Ebeidd
aMedical Biochemistry, Faculty of Medicine, Tanta University, Tanta, Egypt
bHistopathology department, Faculty of medicine, Tanta, Egypt
cPhysiology Departments, Faculty of Medicine, Tanta University, Tanta, Egypt
dClinical pharmacy Department, Faculty of Pharmacy, AL-Delta University, Gamasa, Egypt
A R T I C L E I N F O
Article history:
Received 18 March 2017
Received in revised form 17 May 2017
Accepted 17 May 2017
Keywords:
Diabetes mellitus
Spliced XBP1
ApoptosisProtein disulfide isomerase
Quercetin
LiraglutideA B S T R A C T
Background: The development of complementary treatment strategies that focuses on achieving a
balance between adaptive and apoptotic unfolded protein response (UPR), enhancing endoplasmic
reticulum (ER) homeostasis, and thus preserving b cell mass and function is particularly warranted.
Aim: This study was designed to investigate the effectiveness of the combined treatment by Quercetin
(QUE) and Liraglutide (LIRA) in modulating hyperglycemia, insulin-insensitivity, UPR/ER stress markers,
apoptosis, oxidative stress and inflammation using a high-fat diet/streptozotocin /C0induced type 2
diabetic rat model.
Methods: Sixty male albino rats were allocated into five equal groups: normal control, diabetic control,
LIRA treated diabetic; QUE treated diabetic and combined treatment diabetic groups. Fasting glucose,
insulin, CHOP, macrophage inflammatory protein /C01 a (MIP-1 a) and Bax, Bcl2levels were estimated by
ELISA; mRNA expression levels of the spliced X-box binding protein 1 (XBP1) were estimated using
quantitative real-time RT-PCR, while MDA, advanced oxidation protein products, reduced glutathione
levels and protein disulfide isomerase (PDI) activity were evaluated spectrophotometrically. Pancreatic
tissues were also subjected to histopathological examination.
Results: The combined treatment with both LIRA and QUE causes significant improvements in all the
studied parameters; including XBP1 splicing, CHOP, MIP-1 a, Bax/Bcl 2ratio, PDI activity, as well as
oxidative stress markers as compared to either treatment alone. It also attenuated pancreatic
histopathological damage.
In conclusion: Our study nominates this combination to be used in T2DM to achieve adequate glycaemic
control and to preserve optimal b cell function.
© 2017 Published by Elsevier Masson SAS.
1. Introduction
Type 2 Diabetes Mellitus (T2DM) is a multifactorial chronic
metabolic disease with a remarkably increasing prevalence as a
result of modern lifestyles, overconsumption of energy-dense
foods and reduced physical activity [1]. Hyperglycemia occurs due
to defects in insulin production and secretion from pancreatic
b-cells or insulin action on target tissues [2]. Mounting evidence
suggests that the endoplasmic reticulum (ER) stress, gluco/lipotoxicity, low-grade inflammation as well as oxidative stress
contribute to b-cell loss and insulin resistance [3], thus playing a
crucial role in the pathogenesis of T2DM.
The ER plays essential roles in various cellular processes
including protein folding, intracellular Ca2+ regulation as well as
lipid biosynthesis and metabolism. The ER is equipped with a
robust adaptive response system known as the unfolded protein
response (UPR) that functions to maintain ER homeostasis [4].
Disruption of this homeostasis, as a result of the accumulation of
unfolded proteins, disturbance of luminal calcium homeostasis,
altered redox status and advanced glycation of proteins and lipids,
interferes with proper UPR function and thus initiates ER stress [5].
ER stress activates the UPR via three stress proximal sensors on the* Corresponding author.
E-mail addresses: hanaa.hibishy@med.tanta.edu.eg , hanaahibishy@hotmail.com
(H.H. Gaballah).
http://dx.doi.org/10.1016/j.biopha.2017.05.086
0753-3322/© 2017 Published by Elsevier Masson SAS.Biomedicine & Pharmacotherapy 92 (2017) 331–339
Available online at
ScienceDirect
www.sciencedirect.com

ER membrane: inositol-requiring enzyme 1a (IRE1a), double-
stranded RNA-activated protein kinase-like kinase (PERK), and
activating transcription factor 6 (ATF6) [6].
These stress pathways up-regulate the expression of genes,
such as X-box-binding protein-1 (XBP1), C/EBP (CCAAT/enhancer
binding protein) homologous protein (CHOP) and activating
transcription factor 4 (ATF4) which encode proteins that augment
the ER protein-folding capacity via stimulating the expression of
chaperones and protein folding enzymes as well as to discard the
misfolded proteins through ER-associated degradation machinery
[7]. When the UPR fails to re-establish the ER homeostasis, the pro-
survival function of the UPR turns into an apoptotic signal to
eliminate stressed cells [8].
XBP1, a downstream effector of IRE1, is crucial for glucose
homeostasis, lipid metabolism and promoting ER biogenesis [9].
IRE1 is a type I transmembrane protein with kinase and
endonuclease activities. This endonuclease activity is triggered,
under conditions of increased ER stress, to initiate the splicing of
XBP-1 mRNA by excision of a 26-bp intron [10]. Spliced XBP1
(XBP1s) translocates to the nucleus and initiates transcription of
UPR and non-UPR-associated genes engaged in metabolic reprog-
ramming [11].
Protein disulfide isomerase (PDI) is an ER chaperone that
catalyzes disulfide bond formation and enables the proper protein
folding. It may also have an intracellular anti-in flammatory action
through inhibiting both nuclear factor-kappa-B (NF-kB) activity
and pro-in flammatory cytokine production in macrophages [12].
The pro-apoptotic UPR effector CHOP, a leucine zipper
transcription factor, can be activated by the three branches of
the UPR thus promoting ER stress-induced apoptosis [13]. CHOP
acts through down-regulation of the anti-apoptotic protein Bcl-2
and upregulation of the BH3-only protein Bim, which is essential
for Bax-mediated mitochondrial permeabilization and apoptosis
[14].
Pancreatic b /C0cells depend heavily on an efficient ER function
due to their high rate of insulin synthesis and secretion, making
them more vulnerable to ER stress under hyperglycemic and
hyperlipidemic conditions leading to irresolvable UPR activation
and b-cell death [15]. Therefore, the development of complemen-
tary treatment strategies that focuses on maintaining ER
homeostasis, preventing b cell death and thus preserving b cell
function is particularly warranted to reduce long-term diabetes
complications.
Glucagon-like peptide-1 (GLP-1) is a polypeptide secreted from
intestinal L-cells in response to nutrient ingestion aiming at
lowering blood glucose. It also stimulates b cell replication,
neogenesis and differentiation, and inhibits b cell apoptosis [16].
Liraglutide (LIRA) is a novel long-acting GLP-1 analog that was
recently approved as a once-daily treatment for adults with T2DM
by the US Food and Drug Administration (FDA) [17], however, the
exact underlying mechanisms of its action on various aspects of the
pathogenesis of diabetes mellitus are not yet fully elucidated.
Since medications might have undesirable side effects, there
has been a rising concern in herbal remedies that can be
introduced into the general population with the maximal
preventive outcome and the least side effects [18]. In this
perspective, Quercetin (QUE) is a dietary polyphenolic flavonoid
that occurs ubiquitously in many plant foods, such as buckwheat,
onion, apples and tea. Even with high doses, QUE had safety and
tolerability to animals [19]. QUE exhibits antioxidant and anti-
inflammatory properties. Moreover, it inhibits lipid peroxidation,
platelet aggregation, capillary permeability, and anticipated to
improve diabetic status through enhancing lipid metabolism,
reducing oxidative stress, or modulating pro-in flammatory cyto-
kines [20]. Accordingly, we hypothesized that QUE may have an
additive therapeutic effect when used in combination with LIRA,however, to the best of our knowledge there are no studies so far
had been illustrated the combined in vivo effects of these two
drugs in T2DM.
Therefore the present study was designed to innovatively
evaluate the effectiveness of the combined treatment by QUE and
LIRA in modulating hyperglycemia, insulin-insensitivity, UPR/ER
stress markers, apoptosis, oxidative stress and inflammation using
a high fat diet (HFD)/streptozotocin (STZ)-induced type 2 diabetic
rat model as well as to gain insights into the molecular
mechanisms contributing to b cell dysfunction in T2DM. Decipher-
ing these mechanisms will open new avenues not only in the field
of diabetes therapy but more generally in the management of
obesity and the metabolic syndrome.
2. Materials and methods
2.1. Chemicals and drugs
LIRA (CAS no. 204656-20-2) was provided from Novo (Nordisk
Co., Denmark). STZ (CAS no. 18883-66-4, purity /C21 98%), Quercetin
(CAS no. 117-39-5, purity /C21 98%) and most other chemicals were
purchased from Sigma-Aldrich Chemicals (St. Louis, MO, USA).
2.2. Animals
2.2.1. Experimental animals
This study was conducted on 60 male albino rats (weight,
170 /C6 10 g) obtained from the animal breeding laboratory, Faculty
of science, Tanta University, Egypt. Animals were kept in wire mesh
cages in our animal facility, Faculty of medicine; Tanta University at
25 /C6 2/C14C and a relative humidity of 40–45% with alternative day
and night cycles of 12 h each. Animals had free access to chow and
water ad libitum. Animal care and experiments were conducted in
accordance with the protocols approved by the Ethics Research
Committee, Faculty of medicine, Tanta University, following the
National Institutes of Health guide for the care and use of
Laboratory animals (NIH Publications No. 85–23, revised in 1996).
2.2.2. Induction of HFD-fed/low dose STZ-treated type 2 diabetes
Diabetes was induced according to the method described by
Srinivasan et al. [21] After being acclimatized for one week the rats
were allocated into two dietary regimens by feeding either regular
pellet diet (diet consisting of 5% fat, 53% carbohydrate, 23% protein)
or HFD (consisting of 58% fat, 17% carbohydrate, and 25% protein
with total calori fic value 4.97 Kcal/kg) ad libitum. After the 2 weeks
of dietary manipulation, the group of rats fed with HFD was
injected intraperitoneally (IP) with a low dose of STZ (35 mg/kg,
dissolved in 0.1 M citrate buffer, pH 4.5), while the respective
control rats were given the equivalent volume of vehicle citrate
buffer (pH 4.5; 0.25 mL/kg; IP). One week after STZ injection, rats
were screened for blood glucose levels. The rats with the non-
fasting blood glucose levels of /C21300 mg/dL were considered
diabetic and selected for subsequent studies.
2.2.3. Experimental design and animal grouping
Twelve rats that were fed normal pellet diet were injected
subcutaneously with vehicle citrate buffer (pH 4.5; 0.25 mL/kg)
twice daily for 4 weeks to serve as normal control group. Rats that
were confirmed to be diabetic were divided into four equal groups
(each group comprised of 12 rats) as follows: The first group
received injections of citrate buffer and considered as the diabetic
control, whereas the second and third groups were given either
LIRA (0.3 mg/kg/12 h s.c.) [22], or QUE (50 mg/kg/day IP) [23], and
the fourth group received their combination. Treatments contin-
ued for 4 weeks. The rats were kept feeding on their respective
diets until the end of the study. The dosage was adjusted every332 H.H. Gaballah et al. / Biomedicine & Pharmacotherapy 92 (2017) 331–339

week according to any change in body weight to maintain similar
dose per kg body weight of rat over the entire period of study for
each group. Twice daily dosing was used because the pharmaco-
kinetic half-life of LIRA is only approximately 4 h in rats [24].
2.3. Blood and tissue sampling
2.3.1. Blood sampling
At the end point of the experiment, all animals were fasted
overnight and sacrificed by decapitation under isoflurane anes-
thesia. Blood was collected into a dry sterile centrifuge tube,
allowed to clot at room temperature for 30 min, and then
centrifuged at 1000 x g for 20 min at 4/C14C; serum was separated
and stored at /C070/C14C until the time of analysis.
2.3.2. Tissue sampling
The pancreatic tissue was excised, perfused in situ with ice-cold
0.9% (w/v) NaCl solution, blotted dry on a filter paper, and divided
into 2 parts. One part was preserved in 10% buffered paraformal-
dehyde for histopathological and immunohistochemical examina-
tion. The other part was stored at /C070/C14C till used for preparation of
tissue homogenate and nuclear extracts.
2.3.2.1. Preparation of pancreatic tissue homogenate. One piece of
each specimen was weighed and homogenized in 10 vols of ice-
cold 50 mM phosphate-buffered saline (PBS), pH 7.4 using a
Potter –Elvenhjem tissue homogenizer. Homogenates were
centrifuged at 7700 x g for 30 min at 4/C14C and the resultant
supernatant was frozen at /C070/C14C till used for further analysis.
2.3.2.2. Preparation of pancreatic nuclear and membrane
extracts. Nuclear and membrane extracts from pancreatic
tissue were prepared using the Nuclear/Cytosol Fractionation Kit
(Cat #K266-25, BioVision, Inc., CA, USA) according to the protocol
of the manufacturer.
2.4. Biochemical analysis
2.4.1. Determination of fasting blood glucose by enzymatic
colormetric glucose oxidase method (Biodiagnostic., Egypt).
2.4.2. Determination of fasting serum insulin and calcula-
tion of HOMA-IR index: Fasting serum insulin was determined
using ELISA kit for insulin (Cat# 1606-15, Diagnostic Automation/
Cortez Diagnostics, Inc., CA 91302, USA) following the manufac-
turer ’s protocol. Insulin resistance was assessed using the
homeostasis model assessment index for insulin resistance
(HOMA-IR index) using Matthews ’s equation [25]:
HOMA-IR index = (fasting glucose (mg/dL) /C2 fasting insulin (mU/
mL))/405.
2.4.3. Serum was used for determination of liver enzymes (AST,
ALT), urea, creatinine, total cholesterol (TC) and triacylglycerols
(TAG) by enzymatic-colorimetric methods using commercially
available kits (Biodiagnostic., Egypt).
2.4.4. Total proteins assay: Concentrations of total proteins in
the samples were determined according to the method of Bradford
[26] with bovine serum albumin as a standard (#Cat no. 500–0006,
Bio\\Rad Protein Assay).
2.4.5. CCAAT/enhancer binding protein (C/EBP) homologous
protein (CHOP) levels were estimated in nuclear extract of
pancreatic tissue by an enzyme-linked immunosorbent assay
(ELISA) using a commercially available kit (#Cat 14458; Glory
Science Co., Ltd., USA) according to the manufacture ’s protocol.
2.4.6. Determination of protein disulfide isomerase (PDI)
activity: PDI activity was measured in membrane extract using
turbidimetric assay of insulin disulfide reduction according to themethod of Holmgren [27]. This method is based on the ability of
PDI to reduce disulphide bonds within insulin, resulting in
precipitation of insoluble b chain. The rate of insulin reduction
was measured spectrophotometrically at 670 nm as turbidity
formation from the precipitation of the free insulin B chain.
Dithiothreitol has been shown to reduce the disulfide bonds
completely and was used as positive control.
2.4.7. Assessment of serum macrophage inflammatory
protein 1a (MIP-1 a) levels: MIP-1a: serum levels were assessed
by ELISA kit (Cat # MBS2019111, MyBioSource, Inc., San Diego, CA,
USA) according to the manufacturer's protocol.
2.4.8. Quantitative measurement of spliced XBP1 mRNA by
quantitative real-time reverse transcription PCR (RT-PCR)
i. RNA extraction: Total RNA was extracted from pancreatic tissue
using Qiagen RNeasy Mini Kit according to the manufacturer
protocol. Total RNA concentration and purity were determined
by measuring OD260 and OD260/280 ratio, respectively, on a
NanoDrop spectrophotometer (NanoDrop Technologies, Inc.
Wilmington, USA), RNA was then stored at /C080/C14C.
ii. cDNA synthesis: Total RNA samples were reverse-transcribed
using the RevertAid H Minus First Strand cDNA Synthesis kit
(Cat#K1632, Thermo Scienti fic Fermentas, St. Leon-Ro,
Germany) according to the manufacturer ’s instructions. Briefly,
10 mL of random hexamer primers (Roche, Mannheim,
Germany) were added to 21 mL of RNA which was denatured
for 5 min in the thermal cycler (Biometra, USA). The RNA-
primer mixture was cooled to 4/C14C. The cDNA master mix was
prepared (5 mL of first strand buffer, 10 mM of dNTPs,1 mL of
RNase inhibitor, 1 mL of reverse transcriptase SuperscriptTMII-
RT enzyme and 10 mL of DEPC treated water) according to the
kit protocol and was added to each sample. The total volume of
the cDNA master mix was 19 mL for each sample. This was
added to 31 mL RNA-primer mixture resulting in a reaction
volume of 50 mL, which was then incubated in the programmed
thermal cycler one hour at 42/C14C, followed by inactivation of
enzymes at 95/C14C for 5 min, and finally cooled at 4/C14C. The RNA
was reverse transcribed into cDNA which was then stored at
/C020/C14C until used for PCR.
iii. Real-time quantitative PCR: Only the cDNA derived from
spliced XBP1 mRNA was ampli fied by using a speci fic sense
primer designed to span the 26 bp intron, and thus to anneal only
the spliced XBP1 mRNA. One ml of the cDNA was added to 20 mL
reaction mixture of the QuantiTect SYBR-Green PCR kit (Qiagen)
and 0.5 mM from the speci fic primer pairs for spliced XBP1
(GeneBank accession No. AB076383). This cDNA was then
ampli fied using the Step One instrument (Applied Biosystems,
USA) as follows: Initial denaturation at 95/C14C for 5 min was
followed by 30 cycles with denaturation at 95/C14C for 30 s,
annealing at60/C14Cfor30 s and extensionat72/C14C for30 s. Acontrol
reaction without a DNA template was performed in parallel to
detect genomic DNA contamination. Primer sequences speci fic
for spliced XBP1were designed according to Hirota et al. [28]; as
follows: (sense) 50- GGTCTGCTGAGTCCGCAGCAGG /C030, and
(antisense) 50GGGCTTGGTATATATGTGG- 30. Primers for GAPDH
were included as an internal control: (sense) 50-GAAGGT-
GAAGGTCGGAGTC-30and (antisense) 50-GAAGATGGTGATGG-
GATTTC-30. The determination of the relative levels of gene
expressionwas performed using the comparative cycle threshold
(44Ct) method and normalized to the reference gene GAPDH,
which was not altered by the experimental conditions.
2.4.9. Assessment of apoptotic markers: Bcl-2 and Bax levels
in pancreatic tissue homogenates were estimated using ELISA kits
(USCN Life Science Inc, China) and (EIAab, Science Co., Ltd., China)
respectively, according to the protocol supplied by the manufac-
turer.H.H. Gaballah et al. / Biomedicine & Pharmacotherapy 92 (2017) 331–339 333

2.4.10. Assessment of redox status parameters in pancreatic
tissue homogenates:
a) Tissue malondialdehyde (MDA) Levels were determined using
a method depends on the formation of MDA as an end product
of lipid peroxidation which reacts with thiobarbituric acid
producing thiobarbituric acid reactive substance (TBARS), a
pink chromogen, which can be measured spectrophotometri-
cally at 532 nm [29].
b) Reduced glutathione levels (GSH) were determined using a
commercially available kit (#Cat: GR 2511, Bio Diagnostic,
Egypt). The method is based on the reduction of 5,50dithiobis (2-
nitrobenzoic acid) with GSH to produce a yellow compound, its
absorbance is measured spectrophotometrically at 405 nm [30].
c) Advanced oxidation protein products (AOPPs) were quanti-
fied according to the method by Ohkawa et al. [31] and
expressed as mmol/L of chloramine-T equivalents.
2.5. Histopathological study
After fixation of pancreatic tissue samples in neutral 10%
buffered formalin (pH 7.2) at room temperature, tissues were
dehydrated through graded alcohol solutions, and embedded in
paraf fin. Sections were then stained with hematoxylin and eosin
for histopathological analysis.
2.6. Statistical analysis
Results are expressed as mean /C6 standard deviation (SD).The
intergroup variation was measured by one-way analysis of
variance (ANOVA) followed by the Tukey ’s test. The statistical
evaluation of the data was performed using Graph Pad Prism 4.03
(GraphPad Software, San Diego, California, USA). P values less than
0.05 were considered statistically significant.
3. Results
3.1. Effects of treatment with QUE and/or LIRA on some metabolic
parameters
Concerning body weight changes, before starting the treat-
ments the body weight of all diabetic rats was significantlyincreased as compared to the control group, while at the end of the
treatment period, the body weight of QUE and/or LIRA treated
diabetic groups was significantly decreased as compared to the
untreated diabetic groups. Meanwhile, the fasting serum glucose,
HOMA-IR index, liver enzymes (AST, ALT), urea, creatinine, TC and
TAG levels exhibited significant elevation in diabetic control group
compared to the normal control group (p-value < 0.05). Mean-
while, these parameters were significantly decreased in QUE and/
or LIRA treated diabetic groups as compared to the diabetic control
rats. Likewise, their combination resulted in a highly significant
decline in all these parameters compared to the groups that
received either QUE or LIRA alone. Serum insulin levels displayed
an opposite pattern, being significantly decreased in diabetic rats
as compared to normal controls and significantly increased as a
result of treatment with QUE and/or LIRA .These data are
summarized in Table 1.
3.2. Effects of treatment with QUE and/or LIRA on pancreatic CHOP
protein levels (a UPR downstream marker)
As depicted in Fig. 1, the pancreatic CHOP protein levels showed
a significantly marked elevation in diabetic control group
compared to the normal control group (p-value < 0.05). Mean-
while, QUE and/or LIRA administration to diabetic rats resulted in
significant reduction of pancreatic CHOP levels s levels compared
to the diabetic control group (p-value < 0.05). Moreover, this
decrease was significant in the group that received QUE and LIRA
combination compared to the groups that received either
treatment alone (p-value < 0.05).
3.3. Effects of treatment with QUE And/Or LIRA on protein disul fide
isomerase (PDI) activity
Fig. 2 showed that PDI activity was significantly suppressed in
the diabetic control group compared to the normal control group
(p-value < 0.05). Likewise, PDI activity displayed significant
enhancement in QUE and/or LIRA treated diabetic groups as
compared to the diabetic control group (p-value < 0.05). The
combination of QUE and LIRA resulted in a statistically significant
increase in PDI activity compared to the use of either QUE or LIRA
alone.
Table 1
Effects of treatment with QUE and/or LIRA on some metabolic parameters.
Parameters/ Groups Normal
control groupDiabetic
control groupLIRA treated
diabetic groupQUE treated
diabetic groupQUE & LIRA treated
diabetic groupOne way ANOVA
(n = 12) (n = 12) (n = 12) (n = 12) (n = 12) F
valuep-value
Body
Weight(g)After induction of diabetes and before
starting treatments171.6 /C6 10.8 205.4 /C6 14.2a204.1 /C6 12.9a202.5 /C6 11.6a203.3 /C6 13.4a15.69 <0.0001*
At the end of the treatment period 192.5 /C6 17.6 240.3 /C6 18.5a215.9 /C6 9.1a,b221.7 /C6 10.4a,b220.6 /C6 8.7a,b19.14 <0.0001*
Fasting serum glucose (mg/dl) 85.3 /C6 3.4 294.8 /C6 11.1a129.3 /C6 4.7a,b138.1 /C6 1.6a,b,c118.2 /C6 2.1a,b,c,d2443 <0.0001*
Fasting serum insulin (mIU/ml) 27.8 /C6 1.3 15.6 /C6 3.2a21.4 /C6 1.7a,b18.9 /C6 1.1a,b,c24.1 /C6 2.2a,b,c,d1567 <0.0001*
HOMA-IR index 5.7 /C6 0.03 11.65 /C6 1.9a7.21 /C6 0.12a,b7. 42./C60.14a,b6.8 /C6 0.01a,b85.25 <0.0001*
Serum Total cholesterol (mg/dl) 91.5 /C6 5.2 191.5 /C6 6.3a136.6 /C6 2.3a,b161.7 /C6 4.1a,b,c115.8 /C6 2.1a,b,c,d976.7 <0.0001*
Serum TAG (mg/dl) 75.6 /C6 2.5 189. 1 /C6 1.2a127.8 /C6 2.3a,b152.7 /C6 0.3a,b,c99.6 /C6 1.8a,b,c,d3626 <0.0001*
Serum AST (IU/l) 29.4 /C6 0.5 94.4 /C6 0.8a55.2 /C6 1.1a,b78.6 /C6 0.4a,b,c42.3 /C6 0.8a,b,c,d14493 <0.0001*
Serum ALT (IU/l) 20.7 /C6 0.6 59.2 /C6 0.2a40.0 /C6 0.9a,b49.1 /C6 0.34a,b,c32.1 /C6 0.7a,b,c,d7425 <0.0001*
Serum creatinine (mg/dl) 0.69 /C6 0.05 1.82 /C6 0.16a1.11 /C6 0.08a,b1.36 /C6 0.13a,b,c0.93 /C6 0.15a,b,c,d152.1 <0.0001*
Blood Urea (mg/dl) 34.6 /C6 2.8 91.1 /C6 2.2a51.3 /C6 3.7a,b55.4 /C6 1.5a,b,c43.2 /C6 4.1a,b,c,d618.2 <0.0001*
HOMA-IR index: homeostasis model assessment index for insulin resistance. Values are expressed as mean /C6 SD.
*P was considered significant at <0.05.
aSignificance vs normal control group.
bSignificance vs diabetic control group.
cSignificance vs LIRA treated diabetic group.
dSignificance vs QUE treated diabetic group using One way ANOVA followed by Tukey ’s post hoc test for multiple comparison.334 H.H. Gaballah et al. / Biomedicine & Pharmacotherapy 92 (2017) 331–339

3.4. Effects of treatment with QUE and/or LIRA on spliced XBP1 mRNA
expression
Fig. 3 demonstrated that XBP1 splicing was up-regulated in the
diabetic control group compared to the normal controls (p-
value < 0.05). Administration of QUE and/or LIRA resulted in
significant down-regulation of XBP1-1 splicing compared to the
diabetic controls (p-value < 0.05). This decrease was morepronounced in the group that received QUE and LIRA combination
compared to the groups that received either treatment alone.
3.5. Effects of treatment with QUE and/or LIRA on some inflammatory
and apoptotic markers
Serum MIP-1 a levels as well as Bax/Bcl-2 (pro-/anti-apoptotic)
ratio displayed a significantly marked elevation in the diabetic
control group compared to the normal controls (p-value < 0.05).
Fig. 1. Effects of treatment with QUE and/or LIRA on pancreatic CHOP levels (pg/mg protein). Values are expressed as mean /C6 SD. Number of rats in each group (n = 12). P was
considered significant at <0.05.a Significance vs. Normal control group, b Significance vs. Diabetic control group, c Significance vs. LIRA treated diabetic group, d Significance
vs. QUE treated diabetic group using One way ANOVA followed by Tukey ’s post hoc test for multiple comparison.
Fig. 2. Effects of treatment with QUE and/or LIRA on Protein disulfide isomerase (PDI) activity (4O.D. at 670 nm/mg protein). Values are expressed as mean /C6 SD. Number of
rats in each group (n = 12). P was considered significant at <0.05.a Significance vs. normal control group, b Significance vs. diabetic control group, c Significance vs. LIRA
treated diabetic group, d Significance vs. QUE treated diabetic group using One way ANOVA followed by Tukey ’s post hoc test for multiple comparison.
Fig. 3. Effects of treatment with QUE and/or LIRA on Spliced X-box binding protein /C01 mRNA relative expression levels. Values are expressed as mean /C6 SD. Number of rats in
each group (n = 12). P was considered significant at <0.05. a Significance vs. normal control group, b Significance vs. diabetic control group,c Significance vs. LIRA treated
diabetic group, d Significance vs. QUE treated diabetic group using One way ANOVA followed by Tukey ’s post hoc test for multiple comparison.H.H. Gaballah et al. / Biomedicine & Pharmacotherapy 92 (2017) 331–339 335

These parameters were significantly alleviated in treated diabetic
groups with QUE and/or LIRA compared to the diabetic controls (p-
value < 0.05). These ameliorative effects were significantly evident
in the group that received combined QUE and LIRA treatments
compared to the groups that received either treatment alone (p-
value < 0.05). These data are summarized in Table 2 and Fig. 4.
3.6. Effects of treatment with QUE and/or LIRA on some redox status
parameters
Table 2 showed a significant elevation of MDA and AOPPs levels
accompanied by significant reduction in GSH levels in pancreatic
tissues of diabetic rats compared to the normal controls.
Administration of QUE and/or LIRA resulted in significant decrease
in MDA and AOPPs levels along with significant increase in GSH
levels compared to the diabetic controls (p-value < 0.05). These
improvements in oxidative stress parameters and ensuing
restoration of the balanced redox status were highly significant
in the group that received QUE and LIRA combination compared to
the groups that received either treatment alone.
3.7. Histopathology
As illustrated in Fig. 5, diabetic control group displayed atrophic
islet of Langerhans with loss of its cells. The cells appeared with
pyknotic nuclei and vacuolated cytoplasm. Administration of QUE
and/or LIRA resulted in hyperplasia of islet cells along with
lessened degenerative changes, whilst this remodeling effect was
more prominent in the group that received QUE and LIRAcombination compared to the groups that received either
treatment alone.
4. Discussion
Since an efficient UPR signaling is required for b-cell
adaptation and survival, ER dysfunction has a pivotal importance
in the pathogenesis of T2DM [3]. Our data showed that XBP1
splicing was up-regulated in the diabetic control group
compared to the normal controls, confirming the existence of
ER stress. This finding is consistent with previous studies
reporting an activation of adaptive UPR as depicted by
enhancement of XBP1 splicing in pancreas sections from human
type 2 diabetes subjects [32] and in islets exposed to high glucose
for 24 h in vitro [33]. Well in line, Chan et al. [34] proved that
IRE1/XBP1-mediated adaptive UPR protects against islet inflam-
mation, oxidative stress and cell death in the ob/ob mouse model
of b-cell compensation.
Noteworthy, our data displayed that treatments with either
LIRA or QUE caused down-regulation of XBP1-1 splicing compared
to the diabetic control rats. In harmony with these findings, Liu
et al. [35] showed that LIRA treatment exerted cardioprotective
actions in experimental models of diabetic cardiomyopathy
through decreasing both the expression and splicing of XBP1;
thus inhibiting IRE-a and XBP-1-mediated ER stress.
Regarding the effects of QUE intervention, Zheng et al. [36]
bolstered our finding by noting that pancreatic sXBP1 gene and
protein expression was reduced by QUE in a dose-dependent
manner in an animal model of hypertriglyceridemia-related acuteTable 2
Effects of treatment with QUE and/or LIRA on Serum MIP-1 a and Pancreatic tissue oxidative stress markers.
Parameters/Groups Normal control
groupDiabetic control
groupLIRA treated diabetic
groupQUE treated diabetic
groupQUE & LIRA treated diabetic
groupOne way
ANOVA
(n = 12) (n = 12) (n = 12) (n = 12) (n = 12) F value p-value
Serum MIP-1 a (ng/
ml)0.48 /C6 0.03 0.91 /C6 0.05a0.61 /C6 0.04a,b0.69 /C6 0.03a,b,c0.54 /C6 0.01a,b,c,d277.3 <0.0001*
MDA (nmol/mg
protein)10.6 /C6 0.8 91.2 /C6 6.4a35.4 /C6 3.5a,b29.9 /C6 5.2a,b,c17.7 /C6 2.1a,b,c,d714.0 <0.0001*
AOPPs (mmol/L) 29.1 /C6 1.1 59.8 /C6 12.1a44.7 /C6 1.8a,b40.4 /C6 0.9a,b32.9 /C6 1.4b,c,d56.04 <0.0001*
GSH levels (mg/g
tissue)0.24 /C6 0.02 0.11 /C6 0.03a0.16 /C6 0.04a,b0.18 /C6 0.01a,b0.22 /C6 0.05b,c,d28.58 <0.0001*
Values are expressed as mean /C6 SD.
*P was considered significant at <0.05.
aSignificance vs normal control group.
bSignificance vs diabetic control group.
cSignificance vs LIRA treated diabetic group.
dSignificance vs QUE treated diabetic group using One way ANOVA followed by Tukey ’s post hoc test for multiple comparison.
Fig. 4. Effects of treatment with QUE and/or LIRA on Bax/Bcl-2 ratio. Number of rats in each group (n = 12). P was considered significant at <0.05. a Significance vs. normal
control group, b Significance vs. diabetic control group,c Significance vs. LIRA treated diabetic group, d Significance vs. QUE treated diabetic group using One way ANOVA
followed by Tukey ’s post hoc test for multiple comparison.336 H.H. Gaballah et al. / Biomedicine & Pharmacotherapy 92 (2017) 331–339

pancreatitis. Also, Yao et al. [37] found that QUE significantly
suppressed the ox-LDL- induced activation of ER stress signaling
events, including IRE-a phosphorylation and XBP-1 splicing
upregulation.
The transcription factor CHOP is the downstream effector of the
ER stress-induced apoptotic pathway [13]. Our data revealed a
significant increase in pancreatic CHOP protein levels in diabetic
group compared to the normal controls, indicating the conver-
gence of chronic ER stress towards apoptosis. This finding came in
accordance with previous studies reporting a substantial increase
in CHOP mRNA expression and protein levels in b /C0cells of type 2
diabetic rats [38]. Along this line, previous results were obtained
concerning the up-regulation of CHOP expression in cardiac tissue
[39]; glomerular mesangial cells [40]; bone marrow angiogenic
progenitor cells [41] in mouse models of type 2 diabetes;
highlighting the involvement of ER stress in the pathogenesis of
type 2 diabetic vascular complications.
Moreover, in this study treatments with either LIRA or QUE
were found to be effective in significantly reducing CHOP levels
compared to the diabetic controls, which could potentially be a
cytoprotective mechanism. These findings correlate well with
earlier studies attesting that LIRA administration might reverse the
changes in CHOP gene expression and protein levels and block
CHOP-mediated ER stress by inhibiting the IRE-a/UPR pathway
in the treated diabetic rats [35,42] . As regards effects of QUE, Yao
et al. [37] have reported that QUE has the ability to inhibit the ERstress-CHOP signaling pathway and protect macrophages from ox-
LDL-induced apoptosis, lending credence to our finding.
Intriguingly, our results unveiled for the first time that the
combined treatment with LIRA and QUE has ameliorated the
pancreatic ER stress by significantly down-regulating XBP1-1
splicing as well as reducing CHOP levels compared to either LIRA/
or QUE only treated groups. As there are no studies so far had been
illustrated the combined effect of these two drugs on type 2
diabetes; we argued that these findings might be attributed to the
mutual liaison between the two drugs in the inhibition of ER-stress
related pathways mainly through decreasing p-eIF2 a, p-JNK and
NF-kB signaling along with modulation of the PI3K/Akt [43–45]
and mitogen-activated protein kinase (MAPK) [46,47] signaling
pathways which are deeply involved in the regulation of b-cell
function.
Additionally, our data provided evidence for an altered redox
status in pancreatic tissues of type 2 diabetic rats; as represented
by significant elevation of MDA and AOPPs levels accompanied by
significant reduction in GSH levels in diabetic rats as compared to
the normal controls. Conceivably, ROS may be generated due to
prolonged UPR activation which causes Ca2+ leakage into the
cytosol through inositol trisphosphate receptor, and consequent
Ca2+ influx in the nuclei and mitochondria resulting in altered
calcium homeostasis, ROS generation, cytoskeletal damage and
mitochondrial dysfunction [38,48] . These findings concur earlier
studied which portrayed glucolipotoxicity as the culprit for
Fig. 5. Photomicrographs showing the effect of treatment with QUE and/or LIRA on pancreatic sections from:(A) Normal control group showing large well defined islet of
langerhans composed of cords of endocrine cells with acidophilic cytoplasm (H&E 400/C2); B) Diabetic control group showing atrophic islet of langerhans with loss of its cells.
The cells appeared with pyknotic nuclei and vacuolated cytoplasm (H&E 400/C2); (C) LIRA treated diabetic group showing increase in cells of islets of langerhans with less
degenerative changes (H&E 400/C2); (D) QUE treated diabetic group showing increase in cells of islets of langerhans with less degenerative changes (H&E 400/C2); (E) QUE & LIRA
treated diabetic group showing prominent hyper plastic islet cells (H&E 400/C2). Number of rats in each group (n = 12).H.H. Gaballah et al. / Biomedicine & Pharmacotherapy 92 (2017) 331–339 337

increased oxidative stress and b-cell dysfunction during HFD-STZ-
induced type 2 diabetes in rats [49].
Meanwhile, our data showed that these oxidative stress
markers were effectively normalized by treatments with either
LIRA or QUE compared to diabetic controls; strongly suggesting
protective effects of these drugs in pancreatic b cells. These
findings are in accord with previous reports showing that LIRA
increases b cell mass partly by suppressing oxidative and ER stress,
secondary to the amelioration of glucolipotoxicity [50]. Similarly,
earlier reports signified that QUE administration replenished the
activities of the antioxidant enzymes, down-regulated ROS levels,
and thus attenuated diabetes-related pancreatic [51] as well as
testicular [52] dysfunction in experimental rats.
Protein disulfide isomerase (PDI) is an oxidoreductase chaper-
one catalyzing formation, rearrangement, and breakdown of
disulfide bonds in the ER [53]. An attempt was therefore made
to assess PDI activity in the diabetic pancreas, where it was
significantly decreased in the diabetic control group compared to
the normal controls, suggesting functional defects of molecular
chaperones in diabetes. These findings are biologically plausible as
PDI activity might be decreased in diabetes due to a change in the
oxidation state of its two catalytic sites secondary to diabetes-
induced alterations in redox status. It has been reported that in
diabetes, PDI is present in a mostly reduced form, which is disabled
to perform disulfide bond formation in nascent proteins and,
hence, results in lack of cellular protection [54]. This significant
reductive shift of PDI occurs in parallel with a vast reductive
change in the ER redox status [55]. It is quite intriguing, however,
that Barati et al. [56] reported an increased expression of PDI in
renal tubules of diabetic mice. Taken together, enhanced PDI
protein expression and its reduced/nonactive state could lead to ER
stress and enhanced protein accumulation.
Furthermore, our data exhibited that treatments with either
LIRA or QUE significantly augmented pancreatic PDI activity
compared to the diabetic control rats. This effect could be probably
attributed to the antioxidant properties and active ROS scavenging
activity of either LIRA or QUE.
Since inflammation is tightly linked with insulin resistance
[44]; we sought to further assess the circulating levels of
macrophage inflammatory protein 1a (MIP-1 a/) which is an
endotoxin-inducible C-C family chemokine secreted by macro-
phages and activated T-cells that induces monocyte/macrophage
infiltration and thus implicated in various inflammatory diseases
[57].
We found that circulating MIP-1 a levels were significantly
elevated in the diabetic control group compared to normal
controls. In this regard, it has been recently noted that MIP-1 a
levels were elevated in the adipose tissue of obese mice and
positively correlated with elevated plasma insulin levels [57].
Moreover, oxidative stress and FFA were found to enhance MIP-1 a
release from macrophages lending credence to the hypothesis that
MIP-1 a might be a valuable target for insulin resistance modula-
tion and obesity-induced adipose inflammation [58]. The probable
explanation of this finding is that inflammation and insulin
resistance may directly result from IRE1a activation which, in turn,
triggers the JNK and IKK/NFkB pathways [59].
Our data revealed that treatments with either LIRA or QUE
significantly lowered circulating MIP-1 a levels as compared to the
diabetic control group. This anti-in flammatory action could be
credited to their inhibitory effects on NF-kB activation and TNFa-
induced IkB degradation. Relevant to these findings is that of Tate
et al. [60] who observed that the GLP-1 mimetic, exendin-4,
induced marked attenuation of macrophage infiltration and
reduced adverse cardiac remodeling associated with experimental
diabetes. Likewise, Noh et al. [57] found that QUE suppressed the
MIP-1 a–mediated activation of macrophages by down-regulatingproduction of CCR1/CCR5 and inhibiting the activation of
inflammatory signaling in macrophages.
We further investigated the effects of both drugs on the
pancreatic apoptotic cascade by assaying Bax/Bcl-2 (pro-/anti-
apoptotic) ratio. Our data confirmed activation of the apoptotic
cascade as depicted by significantly increased Bax/Bcl-2 ratio in the
diabetic control group compared to the normal controls, well
aligning with previous reports showing that HFD/STZ induce
apoptotic b-cell death through induction of ER stress, ROS or pro-
inflammatory cytokine production. Noteworthy, our data revealed
that either LIRA or QUE treatments markedly inhibited b-cell
apoptosis represented by the significant decrease in Bax/Bcl-2 ratio
as compared to the diabetic controls. Conceivably, this antiapop-
toic effect could be accredited to their ability to ameliorate ER
stress, oxidative stress and inflammation thus protecting b-cells.
Collectively we proved for the first time that the combined
treatment group showed a significant restoration of the redox
status balance with consequent PDI activation along with potent
anti-in flammatory and anti-apoptotic effects which were more
evident than either treatment alone. This effect may be related to
the additive effect of the two treatments which might be related to
the ability of both drugs to inhibit protein kinase C /C0a /C0
dependent activation of NAD(P)H oxidase, therefore preventing
intracellular NADPH depletion, mitochondrial dysfunction, Nrf2-
mediated antioxidant gene expression down-regulation and
apoptosis [43]. Lastly, the powerful effect of each drug on IKK/
NF-kB and JNK1 inactivation can be considered as a further
additive effect, ultimately preserving b-cell mass and function
[47,61] .
Over and above these findings, our data depicted that either
LIRA and/or QUE treatments caused significant amelioration of
hyperglycemia and insulin resistance as compared to the diabetic
controls. Several mechanisms might be envisaged for these effects,
including alleviation of pancreatic ER stress and oxidative stress as
well as counteracting inflammation and beta cell death, our
findings fit well with such scenarios.
In conclusion, the present study contributes to further
understanding of the effects of combined treatment with both
LIRA and QUE on various aspects of beta cell pathophysiology,
where it causes significant improvements in all the studied
parameters including those for UPR, subsequent ER stress,
apoptosis, inflammation as well as oxidative stress compared to
either treatment alone. Therefore, our study nominates this
combination to be used in T2DM to achieve adequate glycaemic
control and to prevent diabetic complications; however, further
experiments and prospective human clinical trials are warranted
to validate the potential significance of these findings as well as to
point out the proper application conditions and doses.
Conflict of interest statement
Authors declare no conflict of interest.
References
[1] M. Asif, The prevention and control the type-2 diabetes by changing lifestyle
and dietary pattern, J. Edu. Health Promot. 3 (1) (2014) 1.
[2] M.E. Cerf, Beta cell dysfunction and insulin resistance, Front. Endocrinol. 4
(2013) 37.
[3] D.L. Eizirik, M. Miani, A.K. Cardozo, Signalling danger: endoplasmic reticulum
stress and the unfolded protein response in pancreatic islet inflammation,
Diabetologia 56 (2) (2013) 234–241.
[4] R. Bravo, et al., Endoplasmic reticulum and the unfolded protein response:
dynamics and metabolic integration, Int. Rev. Cell Mol. Biol. 301 (2013) 215.
[5] K.N. Keane, et al., Molecular events linking oxidative stress and inflammation
to insulin resistance and b-cell dysfunction, Oxid. Med. Cell. Longevity 2015
(2015) .
[6] B.M. Gardner, et al., Endoplasmic reticulum stress sensing in the unfolded
protein response, Cold Spring Harbor Perspect. Biol. 5 (3) (2013) a013169 .338 H.H. Gaballah et al. / Biomedicine & Pharmacotherapy 92 (2017) 331–339

[7] X.L. Fu, D.S. Gao, Endoplasmic reticulum proteins quality control and the
unfolded protein response: the regulative mechanism of organisms against
stress injuries, Biofactors 40 (6) (2014) 569–585.
[8] R. Sano, J.C. Reed, ER stress-induced cell death mechanisms, Biochim. Biophys.
Acta (BBA)-Mol. Cell Res. 1833 (12) (2013) 3460 –3470 .
[9] P. Walter, D. Ron, The unfolded protein response: from stress pathway to
homeostatic regulation, Science 334 (6059) (2011) 1081 –1086 .
[10] B.M. Gardner, P. Walter, Unfolded proteins are Ire1-activating ligands that
directly induce the unfolded protein response, Science 333 (6051) (2011)
1891 –1894 .
[11] C. Piperi, C. Adamopoulos, A.G. Papavassiliou, XBP1: a pivotal transcriptional
regulator of glucose and lipid metabolism, Trends Endocrinol. Metabol. 27 (3)
(2016) 119–122.
[12] C. Grek, D. Townsend, Protein disulfide isomerase superfamily in disease and
the regulation of apoptosis, Endoplas. Reti. Stress Dis. 1 (1) (2014) 4–17.
[13] A.M. Gorman, et al., Stress management at the ER: regulators of ER stress-
induced apoptosis, Pharmacol. Ther. 134 (3) (2012) 306–316.
[14] I. Tabas, D. Ron, Integrating the mechanisms of apoptosis induced by
endoplasmic reticulum stress, Nat. Cell Biol. 13 (3) (2011) 184–190.
[15] T.J. Biden, et al., Lipotoxic endoplasmic reticulum stress, b cell failure, and type
2 diabetes mellitus, Trends Endocrinol. Metabol. 25 (8) (2014) 389–398.
[16] J.J. Holst, et al., Roles of the gut in glucose homeostasis, Diabetes Care 39 (6)
(2016) 884–892.
[17] M. Parks, C. Rosebraugh, Weighing risks and benefits of liraglutide —the FDA's
review of a new antidiabetic therapy, New Engl. J. Med. 362 (9) (2010) 774–777.
[18] M. Ekor, The growing use of herbal medicines: issues relating to adverse
reactions and challenges in monitoring safety, Front. Pharmacol. 4 (2014) 177.
[19] S. Kumar, A.K. Pandey, Chemistry and biological activities of flavonoids: an
overview, Sci. World J. 2013 (2013) .
[20] G. D'Andrea, Quercetin: a flavonol with multifaceted therapeutic applications?
Fitoterapia 106 (2015) 256–271.
[21] K. Srinivasan, et al., Combination of high-fat diet-fed and low-dose
streptozotocin-treated rat: a model for type 2 diabetes and
pharmacological screening, Pharmacol. Res. 52 (4) (2005) 313–320.
[22] H. Hendarto, et al., GLP-1 analog liraglutide protects against oxidative stress
and albuminuria in streptozotocin-induced diabetic rats via protein kinase A-
mediated inhibition of renal NAD (P) H oxidases, Metabolism 61 (10) (2012)
1422 –1434 .
[23] C. de David, et al., Role of quercetin in preventing thioacetamide-induced liver
injury in rats, Toxicol. Pathol. 39 (6) (2011) 949–957.
[24] J. Sturis, et al., GLP-1 derivative liraglutide in rats with b-cell deficiencies:
influence of metabolic state on b-cell mass dynamics, Br. J. Pharmacol. 140 (1)
(2003) 123–132.
[25] D. Matthews, et al., Homeostasis model assessment: insulin resistance and
b-cell function from fasting plasma glucose and insulin concentrations in
man, Diabetologia 28 (7) (1985) 412–419.
[26] M.M. Bradford, A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye
binding, Anal. Biochem. 72 (1–2) (1976) 248–254.
[27] A. Holmgren, Thioredoxin catalyzes the reduction of insulin disulfides by
dithiothreitol and dihydrolipoamide, J. Biol. Chem. 254 (19) (1979) 9627 –9632 .
[28] M. Hirota, et al., Quantitative measurement of spliced XBP1 mRNA as an
indicator of endoplasmic reticulum stress, J. Toxicol. Sci. 31 (2) (2006) 149–
156.
[29] H. Ohkawa, N. Ohishi, K. Yagi, Assay for lipid peroxides in animal tissues by
thiobarbituric acid reaction, Anal. Biochem. 95 (2) (1979) 351–358.
[30] E. Beutler, O. Duron, B.M. Kelly, Improved method for the determination of
blood glutathione, J. Lab. Clin. Med. 61 (1963) 882–888.
[31] V. Witko-Sarsat, et al., Advanced oxidation protein products as a novel marker
of oxidative stress in uremia, Kidney Int. 49 (5) (1996) 1304 –1313 .
[32] D. Laybutt, et al., Endoplasmic reticulum stress contributes to beta cell
apoptosis in type 2 diabetes, Diabetologia 50 (4) (2007) 752–763.
[33] K.L. Lipson, et al., Regulation of insulin biosynthesis in pancreatic beta cells by
an endoplasmic reticulum-resident protein kinase IRE1, Cell Metab. 4 (3)
(2006) 245–254.
[34] J.Y. Chan, et al., The balance between adaptive and apoptotic unfolded protein
responses regulates b-cell death under ER stress conditions through XBP1,
CHOP and JNK, Mol. Cell. Endocrinol. 413 (2015) 189–201.
[35] J. Liu, et al., Glucagon-like peptide-1 analog liraglutide protects against
diabetic cardiomyopathy by the inhibition of the endoplasmic reticulum stress
pathway, J. Diabetes Res. (2013) 2013 .
[36] J. Zheng, et al., Therapeutic effects of quercetin on early inflammation in
hypertriglyceridemia-related acute pancreatitis and its mechanism,
Pancreatology 16 (2) (2016) 200–210.
[37] S. Yao, et al., Quercetin protects macrophages from oxidized low-density
lipoprotein-induced apoptosis by inhibiting the endoplasmic reticulum stress-
C/EBP homologous protein pathway, Exp. Biol. Med. 237 (7) (2012) 822–831.[38] M. Tharaheswari, et al., Trigonelline and diosgenin attenuate ER stress,
oxidative stress-mediated damage in pancreas and enhance adipose tissue
PPARg activity in type 2 diabetic rats, Mol. Cell. Biochem. 396 (1–2) (2014)
161–174.
[39] S. Chowdhury, et al., Deciphering the role of ferulic acid against
streptozotocin-induced cellular stress in the cardiac tissue of diabetic rats,
Food Chem. Toxicol. 97 (2016) 187–198.
[40] F. Yao, et al., Fatty acid-binding protein 4 mediates apoptosis via endoplasmic
reticulum stress in mesangial cells of diabetic nephropathy, Mol. Cell.
Endocrinol. 411 (2015) 232–242.
[41] M. Bhatta, et al., Enhanced endoplasmic reticulum stress in bone marrow
angiogenic progenitor cells in a mouse model of long-term experimental type
2 diabetes, Diabetologia 58 (9) (2015) 2181 –2190 .
[42] Y. Ji, et al., Liraglutide alleviates diabetic cardiomyopathy by blocking CHOP-
triggered apoptosis via the inhibition of the IRE-a pathway, Mol. Med. Rep. 9
(4) (2014) 1254 –1258 .
[43] A. Shiraki, et al., The glucagon-like peptide 1 analog liraglutide reduces TNF-
a-induced oxidative stress and inflammation in endothelial cells,
Atherosclerosis 221 (2) (2012) 375–382.
[44] X.D. Guo, et al., Quercetin and quercetin-3-O-glucuronide are equally effective
in ameliorating endothelial insulin resistance through inhibition of reactive
oxygen species-associated inflammation, Mol. Nutrit. Food Res. 57 (6) (2013)
1037 –1045 .
[45] S. Shao, et al., Protective action of liraglutide in beta cells under lipotoxic stress
via PI3K/Akt/FoxO1 pathway, J. Cell. Biochem. 115 (6) (2014) 1166 –1175 .
[46] H. Zhu, et al., The neuroprotection of liraglutide against ischaemia-induced
apoptosis through the activation of the PI3 K/AKT and MAPK pathways, Sci.
Rep. 6 (2016) .
[47] J. Lee, et al., The immunostimulating activity of quercetin 3-O-xyloside in
murine macrophages via activation of the ASK1/MAPK/NF- kB signaling
pathway, Int. Immunopharmacol. 31 (2016) 88–97.
[48] C. Koliaki, M. Roden, Alterations of mitochondrial function and insulin
sensitivity in human obesity and diabetes mellitus, Annu. Rev. Nutr. 36 (2016)
337–367.
[49] J. Govindaraj, S.S. Pillai, Rosmarinic acid modulates the antioxidant status and
protects pancreatic tissues from glucolipotoxicity mediated oxidative stress in
high-fat diet: streptozotocin-induced diabetic rats, Mol. Cell. Biochem. 404 (1–
2) (2015) 143–159.
[50] M. Shimoda, et al., The human glucagon-like peptide-1 analogue liraglutide
preserves pancreatic beta cells via regulation of cell kinetics and suppression
of oxidative and endoplasmic reticulum stress in a mouse model of diabetes,
Diabetologia 54 (5) (2011) 1098 –1108 .
[51] O. Coskun, et al., Quercetin, a flavonoid antioxidant, prevents and protects
streptozotocin-induced oxidative stress and b-cell damage in rat pancreas,
Pharmacol. Res. 51 (2) (2005) 117–123.
[52] M. Kanter, C. Aktas, M. Erboga, Protective effects of quercetin against apoptosis
and oxidative stress in streptozotocin-induced diabetic rat testis, Food Chem.
Toxicol. 50 (3) (2012) 719–725.
[53] F.R. Laurindo, L.A. Pescatore, D. de Castro Fernandes, Protein disulfide
isomerase in redox cell signaling and homeostasis, Free Radic. Biol. Med. 52
(9) (2012) 1954 –1969 .
[54] S.et al. Toldo, Altered oxido-reductive state in the diabetic heart: loss of
cardioprotection due to protein disulfide isomerase, Mol. Med. 17 (9) (2011)
1012 .
[55] G. Nardai, et al., Diabetic changes in the redox status of the microsomal protein
folding machinery, Biochem. Biophys. Res. Commun. 334 (3) (2005) 787–795.
[56] M.T. Barati, et al., Differential expression of endoplasmic reticulum stress-
response proteins in different renal tubule subtypes of OVE26 diabetic mice,
Cell Stress Chaperones 21 (1) (2016) 155–166.
[57] H.-J. Noh, et al., Quercetin suppresses MIP-1 a?Induced adipose inflammation
by downregulating its receptors CCR1/CCR5 and inhibiting inflammatory
signaling, J. Med. Food 17 (5) (2014) 550–557.
[58] J. Huber, et al., CC chemokine and CC chemokine receptor profiles in visceral
and subcutaneous adipose tissue are altered in human obesity, J. Clin.
Endocrinol. Metabol. 93 (8) (2008) 3215 –3221 .
[59] H. Kadowaki, H. Nishitoh, Signaling pathways from the endoplasmic reticulum
and their roles in disease, Genes 4 (3) (2013) 306–333.
[60] M.et al. Tate, Exendin-4 attenuates adverse cardiac remodelling in
streptozocin-induced diabetes via speci fic actions on infiltrating
macrophages, Basic Res. Cardiol. 111 (1) (2016) 1.
[61] S.J. Zhou, et al., Liraglutide ameliorates renal injury in streptozotocin-induced
diabetic rats by activating endothelial nitric oxide synthase activity via the
downregulation of the nuclear factor- kB pathway, Mol. Med. Rep. 10 (5) (2014)
2587 –2594 .H.H. Gaballah et al. / Biomedicine & Pharmacotherapy 92 (2017) 331–339 339