Inducible p53 siRNA in glioma [601706]

1
Doxycycline inducible p53 RNA interference in human glioma U87cells

Ashraf Khalil 1, 2 , Ashraf Elfert 1

1Department of Radaition Oncology – Radiation Biolog y
Virginia Commonwealth University, Richmond, Virgini a, USA
2Department of Biochemistry
National Liver Institute, Menoufiya University, Egy pt

Key words: p53, siRNA, Glioma
Running title: Inducible p53 siRNA in glioma
Correspondence to:
Ashraf Khalil, MD, PhD
[anonimizat]

2
ABSTRACT
RNA interference (RNAi) mediated by expression of s hort hairpin RNAs (shRNAs) is a powerful
tool for efficiently suppressing target genes. We h ave developed a doxycycline inducible p53
shRNA lentiviral construct by cloning specific p53 shRNA oligouncleotides into the pLVTHM
plasmid vector. The expression cassette was then su b-cloned into pLVPT plasmid to be under
control of tet on promoter which also drives a gree n fluorescent protein (GFP) as a marker for
shRNA secretion. The pLVPT-p53 shRNA-GFP construct was packed into HEK293 cells with VGVG
and pxs plasmids to generate the recombinant lentiv irus particles that used to transduce
human glioma U87 p53 +ve cells with the p53 shRNA. Doxycycline at 1ug/ml induced expression
of p53 shRNA which leads to 95% down regulation of p53 protein level detected by immunoblot
with anti-p53 antibodies. The induction of p53 shRN A was associated with a co-expression of
the GFP detected by fluorescence microscope. Experi ment of Xenograft tumors developed from
subcutaneously implanted cells into nude mice showe d that shRNA was induced by
administration of doxycycline in the drinking water . shRNA was detected by immunoblot and
the GFP imaging using fluorescence stereotype micro scope. The effects of doxycycline on the
expression of p53 shRNA and GFP were reversible whe n doxycycline was removed from the
drinking water.

3
INTRODUCTION
Short hairpin RNA (shRNA) is a dsRNA molecule that contains a sense strand, an antisense
strand, and a short loop sequence between the sense and antisense fragment. Because the
sense and antisense fragments are complementary in their sequence, the RNA molecules form
hairpin-shaped double-stranded RNA (dsRNA) by flipp ing back on the loop sequence (Kappel et
al., 2007). shRNA is transcribed by a pol III type promoter in the nucleus and the expressed
shRNA is then exported into the cytoplasm where it is processed by a family of enzymes called
dicer into RNA interference (RNAi) which is also kn own as small inhibitory RNA
(siRNAs)(Tiscornia et al., 2003). The efficient and specific suppression of genes by shRNA
constitutes new revenue for studying the physiologi c or the therapeutic role of individual gene.
shRNAs can be expressed into a vector plasmid to ta rget specific gene(Amar et al., 2006).
Conditional RNAi can be obtained by expression of s hRNA from a modified RNA polymerase III
promoter allowing external control of its activity( Kappel et al., 2007). This control require the
expression of a heterologous transcription factor t hat specifically interferes, in the absence of
the inducer molecule such as doxycycline with the a ctivity of the modified promoter(Amar et
al., 2006). p53 is a well known tumor suppressor pr otein that has a central role in preventing
tumor growth (Galluzzi et al., 2008). Activation of p53 in response to various intracellular and
extracellular oncogenic stress signals leads to the transcriptional regulation of large number of
genes important for suppressing tumorigenesis (Lim et al., 2009; Khalil et al., 2011). p53 inhibits
cell growth and proliferation by inducing either ce ll-cycle arrest or induction of apoptotic cell
death (Golding et al., 2009; Geng et al., 2010).

4
In the present study, we developed a doxycycline (D ox) inducible p53 shRNA system which
targets p53 protein in the human glioblastoma U87 c ell line. The shRNA was delivered to the
target cells via a lentiviral vector that poise a G FP as a reporter gene. The selection of the U87
lentivirus transfected cells with kanamycin generat ed a stable U87 p53shRNA-GFP cell line with a
conditional Dox-dependent expression of p53 shRNA. The effects of induction of the p53 shRNA
by dox on p53 level had been tested in cells cultur ed in plates and in xenograft tumor produced
by subcutaneous implantation of the U87 p53shRNA-GFP cells into the flank of nude mice.
MATERIAL AND METHODS
Tissue Culture and Reagents
U87 cells, HEK293T cells were obtained from the Ame rican Type Culture Collection and were
grown in DMEM/F12 medium supplemented with 10% FBS and 1% penicillin/streptomycin at
37°C and 5% CO2. Restriction enzymes and buffers (N ew England Biolabs), T4 ligase and T4
ligase buffer (New England Biolabs, cat. # M0202S), Calf intestinal phosphatase (CIP; New
England Biolabs, cat. # M0290L), Competent E. coli DH5a (Biolabs cat.# C2987H), LB-media
(Roth, cat. # X964.1), LB-agar (Roth, cat. # X965.1 ), Kanamycin, (Applichem, cat. # A1493,0010),
Ampicillin, (Sigma,cat. #D9393-10G), Doxycycline hy clate (Sigma, cat. # D9891-10G), FBS Tet-
free (PAA, cat. # A15-109). Trypsin EDTA solution ( Invitrogen, cat. # 25300-054), Phenol-
chloroform-isoamyl alcohol (Applichem, cat. # A0944 , 0500), BSA (New England Biolabs, cat. #
B9001S), Formaldehyde solution (Sigma, cat. # 33220 ), QIAquick gel extraction kit (Qiagen, cat.
# 28704), and QIAprep spin miniprep kit (Qiagen, ca t. # 27106).

5
Plasmids and Oligos
The plasmid pLVPT, which contains the components of the Tet regulatory system was a gift
from Patrick Aebischer & Didier Trono (Addgene plas mid # 11646, Tet-regulated (Tet-on)
lentiviral vector for transgene (hPGK promoter) – A ND/OR – shRNA (H1 promoter when sub-
cloned from pLVTHM (Addgene#12247)) – 2nd generatio n, with GFP reporter gene
(Wiznerowicz et al., 2003; Szulc et al., 2006). p53 shRNA oligonucleotides consisted of a sense
strand of 19 (p53) nucleotide sequences followed by a short TTCAAGAGA sequences that makes
the hairpin. The anti sense strand is a reverses co mplement of the sense strand with five
thymidines as an RNA polymerase III transcriptional stop signal. The design of the reverse
primer incorporates xbal and ClaI sites juxtaposed on the transcriptional start site. The
sequences of the sense and antisense DNA oligonucle otides were synthesized and provided by
the core laboratory of the Virginia Commonwealth Un iversity. Forward and reverse oligos
TCTAGA CGACTCCAGTGGTAATCTAC TTCAAGAGA GTAGATTACCACTGGAGTC TTTTT AGCTA
AGATCT TCCAAAAAGACTCCAGTGGTAATCTACTCTCTTGAAGTAGATTACCACTGG AG TCGAT

Procedures for generating Dox inducible lentivirus vector for p53 shRNA.
1. Annealing of p53 shRNA oligos to be ready for c loning into the lentiviral vector.
The sense and antisense single strand with the 5' xbal site and a 3' ClaI site were diluted to a
concentration of 1mM. The oligos were annealed, usi ng 1 µl of each oligo in 49µl 1x annealing
buffer in the following order; denaturing at 95°C, 4 min, annealing at 70°C, 10 min. The reaction
was cooled down to 4°C with 0.1°C/sec and kept at 4 °C for an another 15 min.

6
2.Generation of recombinant pLVTHM p53-shRNA vector .
The cloning of p53 shRNA oligos into lentiviral pLV THM vector applies the Klenow reaction that
trim of the insert with the xbal and ClaI restriction enzymes.
Restriction. Prepare two reaction tubes one for the annealed ol igonucleotides and the second
for pLVTHM vector. In the first tube add 1 µg of th e annealed oligonucleotides, 10 µl of 10x
NEBuffer 4, 1 µl 100x BSA, 10 U xbal (NEB), 5 U ClaI (NEB). Add ddH2O to make the final volume
100µl. In the second tube add 5 µg pLVTHM DNA, 10 µ l of 10x NEBuffer 4, 1 µl 100x BSA, 10 U
xbal (NEB), 5 U ClaI (NEB). Add ddH2O to make the final volume 100µl. T he reaction was
incubated at 37°C over night.
Calf intestinal phosphatase (CIP) Reaction. CIP removes phosphate groups from the linearized
vector thus prevents it from religating, thus reduc ing vector-only background after ligation and
transformation. Add 5 U CIP to the vector DNA react ion tube and incubate at 37°C for 30 min.
Extract both the digested vector and insert DNA usi ng the phenol-chloroform-isoamyl alcohol
(PCI) procedure (see PCI section) to inactivate res triction enzymes and CIP.
Ligation. Add 5µl annealed oligos, 6µl prepared plasmid DNA, 1µl T4 ligase (800U) 2µl 10x ligase
buffer and 6µl ddH2O incubate at 16°C overnight fol lowed by 15min at 65°C.
3.Transformation of E.Coli with pLVTHM-p53shRNA vec tor.
5µl ligation mix were transformed into E.coli (see E.Coli transformation section), plated on
Amp+ LB-plates and incubated overnight at 37°C. One colony was picked and grown in 100 ml
LB- containing Amp (1ug/ml) in flask and incubated over night on shaker at 37°C. The LB was

7
spun down at 20000 RPM for 30 min at 4°C to pellet E.Coli and the supernatant was discarded.
The pellet was moved into new tube followed by a DN A extraction using (Qiagen mini prep)
according to the manufacturer protocol. The extract ed DNA of the recombinant pLVTHM-
p53shRNA vector was determined (µg/ul) by Nano Drop H spectrophotometer (Thermo
Scientific, DE, #ND- 001).
4. Subcloning the expression cassette p53 shRNA H1 promoter from pLVTHM into pLVPT and
generation of recombinant dox Inducible pLVPT-p53sh RNA-GFP vector .
The pLVTHM-p53-shRNA was cut with MscI at 4945bp and FspI at 7380bp restriction enzymes
and the insert fragment (2435bp) containing the 3'L TR was cloned to pLVPT plasmid cut with
the same MscI at (5696bp) and FspI at (7805bp) enzymes to generate the dox inducible pLVPT-
p53 shRNA-GFP vector construct.
pLVPT digestion: 10 µg pLVPT DNA, 10 µl 10x NEBuffer 4, 1 µl 100x B SA, 20 U Fspl (NEB) and 20
Msc1 (NEB). Add ddH2O to adjust the volume to 100 µl. I ncubate 50 µl at 37°C for 1h followed
CIP. Gel purification by running DNA on 1% TAE agar ose gel. The 9401 bp fragment was eluted
with 50µl ddH2O (QIAquick Gel Extr. Kit).
pLVTHM-p53 shRNA digestion: 4 µg pLVTHM-p53shRNA DNA 10 µl 10x NEBuffer 4, 1 µ l 100x
BSA, 20 U Msc1 (NEB) and 20 U Fspl (NEB), adjust th e volume with ddH2O to 50 µ. Incubate 50
µl at 37°C for 1h followed CIP. Gel purification (1 % TAE agarose gel) of the 2435 bp p53 shRNA
H1 promoter insert fragment. Eluted with 50µl ddH2O (QIAquick Gel Extr. Kit).

8
ligation: add 60 nmol prep. pLVPT, 210 nmol prep. pLVTHM-p53 shRNA incert, 1 µl T4 ligase
(400 U) 2 µl 10x ligase buffer, add H2O to adjust t he volume to 20µl. Incubate at 16°C overnight
followed by 15min at 65°C.
5.Transformation of E.coli with the Dox Inducible p LVPT- p53 shRNA-GFP vector.
5µl of ligation mix were transformed into E.coli an d the DNA of the recombinant pLVPT-p53
shRNA-GFP vector was extracted as previously descri bed in section 3.
6. pLVPT- p53shRNA-GFP Lentivirus production.
Recombinant lentivirus particles were produced by transient transfection in HEK293T cells
together with VSVG and psx plasmid using the calciu m phosphate method. HEK 293T cells were
seeded in 15 cm plates in a density of 5×10 6 cells/plate 24h before transfection. The DNA was
mixed with 400 μl 1.25 M CaCl2 and 1.5 ml ddH2O. 2 ml of 2x HBS were added to the DNA
mixture, and then the transfection mixture was adde d slowly to the HEK 293 cells plate. After
4h the plates were washed twice with PBS and 20 ml culture media was added. The
supernatant containing the virus was harvested afte r 48 and 72 h, spun down at 3000 RPM, 10
min at 4°C to remove cell debris. The supernatant w as then filtered through a 0.45 μm filter.
The virus containing supernatant was used directly to transduce the cells. The supernatant was
ultra centrifuged 2h at 50,000 g to concentrate the virus for storage and later usage(Segura et
al., 2010).
7.U87 cells transduction with pLVPT- p53shRNA-GFP L entivirus.

9
U87 cells were plated at 30% density in 12 well pla te and 24 h later, 2ml of the supernatant
containing pLVPT-p53 shRNA-GFP Lentivirus was added to each well for 4 h, then replaced with
fresh media and the cells were cultured for 48 h. C ells were trypsinized and reseeded in 6 well
plate and cells were selected for the Kanamycin res istance gene by adding 3µg/ml Kanamycin
to produce a permanently stable transfected U87 p53shRNA-GFP cell line. Cells were maintained in
Kanamycin for at least 3 successive passages to ens ure full selection of the resistant cells. Cells
were induced by adding 1 µg /ml Dox (Sigma) in the culture media for 3 days. Cells were
examined by fluorescent microscope using excitation /emission filters 470/525 nm, for the
expression of the reporter GFP and by immunoblot wi th anti p53 antibody to detect down
regulation of p53.
Transformation of E.Coli. The procedure was performed using the heat shock m ethod. 50-100
μl of competent E.Coli cells were thawed on ice and incubated 20 min on ice with a variable
amount of DNA. The E.Coli was heated to 42 °C for 4 5s and then immediately cool down by
incubation on ice for 2 min. 500 μl LB-medium were added and the mixture was incubated at 37
°C, shaking for 60 min. Bacteria were finally plate d on LB-plates with the corresponding
antibiotic (Amp, Kan) for the plasmid DNA selection and incubated at 37 °C over night(Hanahan
et al., 1991).
Phenol-chloroform-isoamyl alcohol (PCI) extraction. The PCI extraction applies a salt buffer
formulation to precipitate the DNA. To the heat ina ctivated Klenow reaction mixture 50 µl H2O
were added to a total volume of 100 µl. 10µl 3M sod ium acetate pH 5 were added and an equal
amount to the total of 110µl of Phenol/Chloroform. The mixture was vortexed and centrifuged

10
at 13000 rpm for 5 min at 4 °C. The top layer conta ining the DNA was transferred to a fresh
tube and 300 µl of ice cold ethanol were added, vor texed and incubated at -20°C for 15 min.
The mixture was centrifuged at 13000 rpm at 4°C, fo r 30 min. The supernatant was discarded
and the DNA pellet washed with 70% ethanol, air dri ed and resuspended in 30 µl H2O (Kappel
et al., 2007).
Western Blot Analysis
Western immunoblots were obtained from total protei n extracts as described previously(Khalil
et al., 2013). Briefly treated cells in 6 cm dishes were washed with ice-cold PBS containing 2
mmol/L SOV. Cells were collected, and resuspended i n lysis buffer. Cell lysate were vortexed,
and incubated at 4°C for 30 minutes, centrifuged at 13,000 × g for 15 minutes at 4°C .The
supernatant was collected and sample buffer contain ing 0.1 mol/L dithiothreitol was added.
Proteins were resolved on a 12% SDS-PAGE and then t ransferred to a polyvinylidene fluoride
(PVDF) membrane (Millipore, Bedford, MA, USA). The blots were labeled using the following
primary antibodies anti-p53 (Cell Signaling Technol ogy Antibody #9282; rabbit polyclonal;
1:1000 dilution), and anti-β-actin, (Antibody #4967 ; rabbit polyclonal; 1:1000 dilution). Proteins
were visualized using an infrared-emitting conjugat ed secondary antibodies anti-rabbit IRDYE
800 (Rockland Immunochemicals, Gilbertsville, PA) d iluted 1:15000, and the Odyssey imaging
system (LI-COR Biosicences, Lincoln, NE, USA)(Khali l et al., 2011).
Subcutaneous implantation of U87 p53shRNA- GFP cells in nude mice.
All protocols involving work with live animals were reviewed and approved by Animal Care
Committee of the Virginia Commonwealth University. U87 and U87 p53shRNA-GFP 5 M cells were

11
subcutaneously implanted bilaterally into the flank s of nude mice 8 weeks old males, n= 6
mice(Khalil et al., 2013). Induction of p53 shRNA expression in mice was done 14 days after cell
inoculation by dissolving 2 mg/ml doxycycline and 5 % sucrose in drinking water. Dark brown
bottles were used as Dox is light-sensitive, and wa ter was replaced other day. Tumor size was
measured by caliper and tumor volume was calculated from the measurements (tumor length x
tumor width2) pi/6. GFP fluorescence was detected u sing a Zeiss SV11 stereomicroscope (Zeiss,
Jena, Germany) with a Hamamatsu digital CCD camera C4742-95-12NRB (Hamamatsu Corp.,
Bridgewater, NJ) and AttoArc2/HB 100 Arc variable i ntensity microscopy illuminator system
(Zeiss) using excitation/emission filters (470/525 nm). Images were captured using AxioVision
version 3.1 software and processed with Adobe Photo Shop version 5.0 (Golding et al., 2004).
RESULTS
1. Induction of p53 shRNA and GFP in human glioma U 87 p53shRNA-GFP cells lines in vitro. Human
glioma U87 p53shRNA-GFP cells were seeded in 6 well plates in the absence o r presence of 0.25, 0.5,
and 1ug/ml Dox for 3d to induce p53shRNA. Cells wer e then examined by florescence
microscope for the expression of the reporter GFP p rotein as marker of successful induction
and expression of p53 shRNA. Representative images, provided in (fig1.a), show the expression
of GFP with Dox treatment for 3d. Immunoplot with a nti p53, showed that Dox induced a dose
dependent p53 shRNA that reduced the level of p53 p rotein by 95% relative to the control
untreated at 1µg/ml (fig1b). Parental cells and cel ls transfected with the negative control
plasmid did not show any GFP signal on microscope e xamination, (data not shown).
Immunoplot shows p53 level did not change in the ab sence or the presence of Dox (fig.1c).

12
Effect of Dox withdrawal from the media on GFP. Human gliomas U87 p53shRNA-GFP treated with
Dox for 3d examined by fluorescence microscope were GFP +ve as in (fig1.a). The media were
exchanged for Dox free media and incubated for anot her 3 days. Cells were reexamined by the
fluorescence microscope for GFP. GFP signal was not detected indicating switch off the p53
shRNA-GFP promoter stop of p53 shRNA expression.
2. Induction of p53shRNA and GFP in human glioma U 87 p53 shRNA-GFP cells lines grown into
xenograft tumor.
The effect of Dox induced expression of p53 shRNA w as assessed in Human glioma U87 p53shRNA-
GFP cells grow into xenograft tumor in the flank of 6 n ude mice. 14 days after cells inoculation
when the tumors were established, 4 mice were given 2mg/ml Dox in drinking water as
described in the Methods. Dox dosing continued for 2 weeks during that period tumor growth
was assessed by caliper measurement twice per week. Mice were also imaged by florescence
microscope to determine the GFP expression. Represe ntative images, provided in (fig2.a) , show
the expression of GFP could be detected in the tumo r of mice which received Dox in the
drinking water. No GFP detection in mice which did not receive Dox in the drinking water
(images are not shown). After completing the two we eks of Dox, 2mice out of the 4 receiving
Dox were euthanized and the tumors were harvested a nd sectioned as described in the
Methods. Representative images, provided in (fig2.b) , show the expression of GFP detected in
the tumor of mice which received Dox. Tumor sample were processed for immunoblot with anti
p53. Tumor specimens from mice received Dox in the drinking water showed 95% reduction in
p53 level (fig.5b-c) . The other two mice which were kept alive, Dox was removed from the

13
drinking water and mice were imaged for GFP and nee dle biopsy of the tumor was obtained.
Representative images at 1, 3, and 7 d after Dox re moval provided in (fig2.d) , show the
expression of GFP was gradually decreased and becam e undetectable after one week of Dox
removal. Immunoblots of p53 with the corresponding sample show that p53 has returned to
the basal level after 7d of Dox removal.

Fig. 1 Induction of p53 shRNA with Dox tracked by G FP and immunoblot. U87 p53shRNA-GFP cells,
were seeded in the absence (-) or presence (+) of D ox as labeled for 3d. (A) Florescent photo
microscopic picture (excitation/emission filters 47 0/525 nm) showing detection of GFP
expressing cells with 1µg/ml Dox treatment. (B) Immunoblot with anti p53 antibody and β-actin
antibody. (C) Parental U87 cell line and U87 expressing the nega tive control empty vector. Cells
were seeded in the absence (-) or presence (+) of 1 µg/ml Dox for 3d. In B and C blotting with β-
actin indicates equal loading. p53 bands intensity were quantified and normalized to the β-actin
using licor software; 1x represent the basal p53 le vel of the untreated cells.

14

Fig2 (a) GFP protein is expressed in the tumors of mice rece ived Dox in the drinking water.
Serial fluorescence images of the expressed GFP in tumor grown from U87 p53shRNA-GFP cells in
living nude mice received 1mg/ml Dox in the drinkin g water. Images were taken at 3, 7, 10 and
14 days of Dox treatment. (b) Bright field and GFP filter (excitation/emission fi lters 470/525
nm) images of the excised tumor immediately after e uthanasia. (c) Immunoblot of tumors
lysate with anti p53, and anti β actin. (d-e) Serial fluorescence images of the xenograft tumor in
the living nude mice and its corresponding needle b iopsy immunoblot. Images and sample were
at 1, 3, and 7d after withdrawal of Dox.
DISCUSSION
The method provided in this study describes the gen eration of permanently transfected human
glioma cell lines with a Dox inducible p53 shRNA wi th GFP reporter delivered by the lentiviral
construct. The expression of p53 shRNA molecule was designated to be processed by RNase III
class of enzymes known as Dicer to produce the p53 siRNA molecule. The siRNA down regulates
p53 protein via binding with its mRNA leading to it s cleavage thus preventing p53 translation

15
and synthesis. Dox induction of p53 shRNA in the tr ansfected cells resulted in efficient p53 gene
silencing with respect to time and dose of Dox. In both in vitro and in vivo studies down
regulation of up to 95% of p53 protein had been ach ieved. This down regulation was detected
by immunoblots with anti p53 protein of samples obt ained from in vitro tissue plates or
xenograft tumor grown in the flanks of nude mice. p 53 protein level down regulation was dose
and time dependent as it require 3 d to reach the m aximum reduction in the p53 level at
1µM/ml. On the other hand p53 gradually return to i ts basal level when shRNA production
decreased secondary to Dox removal from the system. Within 3d of Dox removal p53 was
detected by immunoblot at level comparable to the c ontrol untreated cells.
The presence of GFP in the expression cassette of t he system gives the privilege of live imaging
of the cells population that integrated the p53 shR NA in their genome as both shRNA and GFP
were under the control of the same promoter. GFP wa s consistently expressed in cells treated
with Dox and the signal was correlated with the cel ls growth. The increase in the tumor volume
due to tumor growth was associated with an increase in GFP expression detected by serial
imaging of the tumor. On the other hand when the GF P expressing cells were re-grown in Dox
free media or when Dox was removed from the drinkin g water of the mice bearing the tumors,
the GFP declined gradually over time. This decline of the GFP indicated switching off the
expression of p53 shRNA that lead to decrease in p5 3 siRNA and increase of p53 level.
In conclusion this system provide a valuable tool f or studying the effect of the knock down of
p53 protein in malignant cells and provide an appli cable controlled reversible method for p53
expression both in tissue culture plates and in the animal model experiments.

16
REFRENCES
Amar, L., M. Desclaux, N. Faucon-Biguet, J. Mallet and R. Vogel (2006). "Control of small inhibitory R NA
levels and RNA interference by doxycycline induced activation of a minimal RNA polymerase III
promoter." Nucleic Acids Res 34 (5): e37.
Galluzzi, L., E. Morselli, O. Kepp, N. Tajeddine an d G. Kroemer (2008). "Targeting p53 to mitochondria for
cancer therapy." Cell Cycle 7(13): 1949-55.
Geng, Y., K. C. Walls, A. P. Ghosh, R. S. Akhtar, B . J. Klocke and K. A. Roth (2010). "Cytoplasmic p53 and
activated Bax regulate p53-dependent, transcription -independent neural precursor cell
apoptosis." J Histochem Cytochem 58 (3): 265-75.
Golding, S. E., R. N. Morgan, B. R. Adams, A. J. Ha wkins, L. F. Povirk and K. Valerie (2009). "Pro-sur vival
AKT and ERK signaling from EGFR and mutant EGFRvIII enhances DNA double-strand break
repair in human glioma cells." Cancer Biol Ther 8(8): 730-8.
Golding, S. E., E. Rosenberg, A. Khalil, A. McEwen, M. Holmes, S. Neill, L. F. Povirk and K. Valerie ( 2004).
"Double strand break repair by homologous recombina tion is regulated by cell cycle-
independent signaling via ATM in human glioma cells ." J Biol Chem 279 (15): 15402-10.
Hanahan, D., J. Jessee and F. R. Bloom (1991). "Pla smid transformation of Escherichia coli and other
bacteria." Methods Enzymol 204 : 63-113.
Kappel, S., Y. Matthess, M. Kaufmann and K. Strebha rdt (2007). "Silencing of mammalian genes by
tetracycline-inducible shRNA expression." Nat Proto c 2(12): 3257-69.
Khalil, A., R. N. Morgan, B. R. Adams, S. E. Goldin g, S. M. Dever, E. Rosenberg, L. F. Povirk and K. V alerie
(2011). "ATM-dependent ERK signaling via AKT in res ponse to DNA double-strand breaks." Cell
Cycle 10 (3): 481-91.
Khalil, A. A., M. J. Jameson, W. C. Broaddus, P. S. Lin and T. D. Chung (2013). "Nicotine enhances
proliferation, migration, and radioresistance of hu man malignant glioma cells through EGFR
activation." Brain Tumor Pathol 30 (2): 73-83.
Khalil, A. A., M. J. Jameson, W. C. Broaddus, P. S. Lin, S. M. Dever, S. E. Golding, E. Rosenberg, K. Valerie
and T. D. Chung (2013). "The Influence of Hypoxia a nd pH on Bioluminescence Imaging of
Luciferase-Transfected Tumor Cells and Xenografts." Int J Mol Imaging 2013 : 287697.
Lim, D. Y. and J. H. Park (2009). "Induction of p53 contributes to apoptosis of HCT-116 human colon
cancer cells induced by the dietary compound fiseti n." Am J Physiol Gastrointest Liver Physiol
296 (5): G1060-8.
Segura, M. M., A. Garnier, Y. Durocher, S. Ansorge and A. Kamen (2010). "New protocol for lentiviral
vector mass production." Methods Mol Biol 614 : 39-52.
Szulc, J., M. Wiznerowicz, M. O. Sauvain, D. Trono and P. Aebischer (2006). "A versatile tool for
conditional gene expression and knockdown." Nat Met hods 3(2): 109-16.
Tiscornia, G., O. Singer, M. Ikawa and I. M. Verma (2003). "A general method for gene knockdown in
mice by using lentiviral vectors expressing small i nterfering RNA." Proc Natl Acad Sci U S A
100 (4): 1844-8.
Wiznerowicz, M. and D. Trono (2003). "Conditional s uppression of cellular genes: lentivirus vector-
mediated drug-inducible RNA interference." J Virol 77 (16): 8957-61.

17
/afii62833/afii62761 /afii62825/afii62832/afii62765/وafii62782/afii62761 /afii62798/afii62832/afii62762/afii62769/afii62765/ ٣٥ afii62825/afii62832/afii62765/وafii62782/afii62762/afii62817/ر اafii62829/afii62827/afii62799/و afii62782/afii62794/afii62777/afii62836/ اafii62767/afii62775/afii62765/afii62782/afii62832/afii62768/afii62754/afii62765 /afii62833/afii62785/وآafii62780/afii62817/اafii62825/afii62818/afii62832/afii62815/afii62832/afii62784 /afii62760/afii62831/afii62841/afii62777 /afii62833/afii62808
/afii62820/afii62829/afii62766/afii62784/afii62841/afii62761/afii62829/afii62831/afii62841/afii62772/afii62817/اafii62760 /afii62764/afii62831/afii62782/afii62788/afii62762/afii62817ا
/ afii62819/afii62832/afii62818/afii62777 /ؤفafii62782/afii62817/ اafii62780/afii62762/afii62802 /فafii62782/afii62787/ت-أ afii62782/afii62809/afii62817/ اafii62810/afii62784/afii62829/afii62831 /فafii62782/afii62787أ
/ afii62764/afii62831/afii62829/afii62832/afii62775/afii62817/ء اafii62760/afii62832/afii62821/afii62832/afii62815/afii62817/ اafii62822/afii62785/afii62811 – /afii62764/afii62832/afii62808/afii62829/afii62824/afii62821/afii62817/ اafii62764/afii62803/afii62820/afii62760/afii62771 /afii62780/afii62762/afii62815/afii62817/ اafii62780/afii62827/afii62803/afii62820
/afii62833/afii62761/afii62782/afii62803/afii62817/ اafii62792/afii62778/afii62818/afii62821/afii62817ا

/ إن afii62764/afii62808/وafii62782/afii62803/afii62821/afii62817/ اafii62764/afii62832/afii62824/afii62812/afii62766/afii62817/ا afii62798/afii62832/afii62762/afii62769/afii62766/afii62761 /afii62795/afii62821/afii62775/afii62817/ويا afii62829/afii62824/afii62817/ل ا afii62829/afii62784/afii62782/afii62817/ ا afii62819/afii62821/afii62802 /afii62798/afii62832/afii62762/afii62769/afii62765 /afii62833/afii62808 /afii62764/afii62817/afii62760/afii62803/afii62809/afii62817/ اafii62819/afii62757/afii62760/afii62784/afii62829/afii62817/ اafii62825/afii62820 /afii62825/afii62832/afii62772/afii62817/ أ afii62804/afii62824/afii62821/afii62817 /afii62764/afii62772/afii62832/afii62766/afii62823
/afii62795/afii62820/afii62760/afii62775/afii62817/ة اafii62782/afii62809/afii62787 /afii62764/afii62821/afii62771/afii62782/afii62765 /ويafii62829/afii62824/afii62817/ل ا afii62829/afii62784/afii62782/afii62817/ . ا afii62780/afii62821/afii62766/afii62803/afii62765/و afii57447/afii62781/وي ه afii62829/afii62824/afii62817/ اafii62798/afii62831/afii62782/afii62788/afii62817/ اafii62825/afii62820 /afii62782/afii62832/afii62806/afii62790 /ءafii62783/afii62771 /دafii62829/afii62771/ وafii62833/afii62818/afii62802 /afii62764/afii62832/afii62824/afii62812/afii62766/afii62817ا
/ afii62795/afii62821/afii62775/afii62818/afii62817 /afii62819/afii62768/afii62760/afii62821/afii62820 /لafii62829/afii62784/afii62782/afii62817/ ا afii62780/afii62802/اafii62829/afii62812/afii62817/ اafii62825/afii62820 /دafii62780/afii62802 /afii62833/afii62808 /afii62764/afii62832/afii62824/afii62820/afii62836/ ا afii62760/دهafii62780/afii62802 /نafii62829/afii62815/afii62765/afii62760/afii62820 /afii62760/afii62762/afii62817/afii62760/afii62805/ة ٠٢و afii62780/afii62802/afii62760/afii62811 /afii62828/afii62832/afii62824/afii62832/afii62820/ أ afii62764/afii62808/afii62760/afii62793/afii62838/afii62760/afii62761 /afii62833/afii62817 إ
/ afii62760/afii62827/afii62794/afii62803/afii62762/afii62817 /afii62764/afii62818/afii62821/afii62815/afii62820 /afii62764/afii62803/afii62832/afii62762/afii62796 /ن ذاتafii62829/afii62815/afii62765/ وafii62760/afii62827/afii62803/afii62762/afii62766/afii62765 /يafii62782/afii62777/ة وأafii62780/afii62802/afii62760/afii62811 /afii62825/afii62831 /afii62782/afii62788/afii62803/afii62817/ اafii62816/afii62818/afii62765 /afii62813/afii62762/afii62785/afii62765 /afii62833/afii62766/afii62817/ واafii62780/afii62802/اafii62829/afii62812/afii62817/ اafii62825/afii62820 /afii62782/afii62777/ء أafii62783/afii62771 /afii62760/afii62821آ
/دوج afii62783/afii62821/afii62817/وي اafii62829/afii62824/afii62817/ اafii62795/afii62820/afii62760/afii62775/afii62817/ اafii62833/afii62808 /ثafii62780/afii62775/afii62831 /afii62782/afii62820/afii62836/دي ا afii62755/afii62831 /يafii62781/afii62817/ا afii62833/afii62817/ إ afii62795/afii62820/afii62760/afii62774 /afii62825/afii62831/afii62829/afii62815/afii62765/ وafii62764/afii62818/afii62821/afii62815/afii62821/afii62817/ اafii62780/afii62802/اafii62829/afii62812/afii62817/ اafii62816/afii62818/afii62765 /فafii62760/afii62809/afii62766/afii62817ا
/سafii62829/afii62761/afii62780/afii62817/ راس اafii62828/afii62762/afii62788/afii62831 /afii62833/afii62817/afii62829/afii62784/وي رafii62829/afii62823 .
/ راafii62825/afii62831/afii62829/afii62815/afii62765 /afii62822/afii62766/afii62831 /ويafii62829/afii62824/afii62817/ اafii62795/afii62821/afii62775/afii62817/ اafii62779/afii62785/afii62823 /afii62780/afii62824/afii62802 / س afii62833/afii62818/afii62802 /فafii62782/afii62803/afii62766/afii62831 /يafii62781/afii62817/س اafii62829/afii62761/afii62780/afii62817/لا afii62829/afii62784/afii62782/afii62817/ ا afii62828/afii62797/afii62762/afii62769/afii62765 /ادafii62782/afii62821/afii62817/ اafii62825/afii62832/afii62772/afii62817/afii62760/afii62761 /صafii62760/afii62778/afii62817ا
/ afii62764/afii62797/afii62784/اafii62829/afii62761 /afii62783/afii62827/afii62771 /afii62780/afii62811 /نafii62829/afii62815/afii62831 / أنafii62780/afii62803/afii62761 /afii62822/afii62831/afii62783/afii62823/ إ afii62760/afii62812/afii62817/afii62760/afii62761 /فafii62782/afii62803/afii62831 /afii62833/afii62818/afii62802 /يafii62829/afii62766/afii62775/afii62821/afii62817/ء اafii62783/afii62772/afii62817/ق اafii62841/afii62797/afii62823/ اafii62828/afii62824/afii62802 /afii62773/afii62766/afii62824/afii62831 /afii62760/afii62821/afii62820 /afii62804/afii62796 /ة ٠٢ afii62780/afii62802/afii62760/afii62811
/afii62828/afii62832/afii62824/afii62832/afii62820/ أ afii62795/afii62820/afii62760/afii62775/afii62817/ اafii62804/afii62820 /afii62780/afii62775/afii62766/afii62765 /afii62833/afii62766/afii62817/لوا afii62829/afii62784/afii62782/afii62817/ ا afii62828/afii62761 /afii62764/afii62790/afii62760/afii62778/afii62817/ة اafii62782/afii62809/afii62788/afii62817/ اafii62764/afii62821/afii62771/afii62782/afii62765 /afii62804/afii62824/afii62821/afii62765/س . و afii62829/afii62761/ راس دafii62783/afii62832/afii62827/afii62772/afii62766/afii62761 /afii62760/afii62824/afii62821/afii62811 /afii62780/afii62812/afii62817
/afii62833/afii62761 /afii62825/afii62832/afii62772/afii62817/afii62760/afii62761 /afii62764/afii62790/afii62760/afii62777 / ٣٥ afii62822/afii62765/لو afii62760/afii62777/ إد afii62825/afii62832/afii62765/وafii62782/afii62762/afii62817/ اafii62833/afii62818/afii62802 /يafii62829/afii62766/afii62775/afii62831 /يafii62781/afii62817/ اafii62780/afii62832/afii62820/زafii62841/afii62761 /afii62833/afii62808 /ءafii62783/afii62772/afii62817/ا اafii62781/ه afii62782/afii62794/afii62777/afii62836/ ا afii62764/afii62817/afii62840/afii62780/ازآ afii62782/afii62808 إ
/afii62764/afii62808/afii62760/afii62793/afii62838/afii62760/afii62761 /afii62833/afii62817/ن إ afii62829/آ afii62782/afii62765/afii62829/afii62820 /afii62782/afii62762/afii62817/ ا afii62819/afii62821/afii62803/afii62831/afii62840 /afii62780/afii62832/afii62820/زafii62841/afii62762/afii62817/afii62760/afii62761 /صafii62760/afii62778/afii62817/ا afii62840/ إ afii62833/afii62785/وآafii62780/afii62817/د اafii62829/afii62771/ وafii62833/afii62808 /afii62825/afii62818/afii62832/afii62815/afii62832/afii62784 /afii62782/afii62820/afii62836/ ا afii62828/afii62762/afii62788/afii62831 /يafii62781/afii62817ا
/afii62822/afii62815/afii62775/afii62766/afii62817/ح اafii62760/afii62766/afii62809/afii62820 . /afii62822/afii62765 /ادafii62780/afii62802/ إ afii62816/afii62817/م ذafii62780/afii62778/afii62766/afii62784/ اafii62822/afii62768 /afii62780/afii62832/afii62820/زafii62841/afii62762/afii62817/afii62760/afii62761 /صafii62760/afii62777 /سafii62782/afii62832/afii62808 /afii62833/afii62766/afii62824/afii62832/afii62817 /afii62819/afii62821/afii62802 /afii62780/afii62803/afii62761 /afii62825/afii62820 /afii62822/afii62768 /afii62780/afii62802/اafii62829/afii62812/afii62817/ واafii62780/afii62832/afii62820/زafii62841/afii62762/afii62817ا
/ afii62819/afii62811/afii62760/afii62824/لآ afii62760/afii62777/دafii62838 /afii62831/afii62782/afii62788/afii62762/afii62817/ اafii62764/afii62832/afii62823/afii62760/afii62796/afii62782/afii62785/afii62817/ اafii62760/afii62831/afii62841/afii62778/afii62817/ اafii62833/afii62808 /afii62828/afii62772/afii62820/ ودafii62833/afii62824/afii62832/afii62772/afii62817/ن اafii62829/afii62815/afii62821/afii62817/ا afii62820/afii62829/afii62766/afii62784/afii62841/afii62761/afii62829/afii62831/afii62841/afii62772/afii62817/ اafii62822/afii62784/afii62760/afii62761 /afii62764/afii62808/وafii62782/afii62803/afii62821/afii62817/ اafii62764 /afii62760 . /afii62780/afii62812/afii62817
/انafii62782/afii62758/afii62809/afii62817/ واafii62764/afii62802/روafii62783/afii62821/afii62817/ اafii62760/afii62831/afii62841/afii62778/afii62817/ اafii62833/afii62808 /ذجafii62829/afii62821/afii62824/afii62817/ اafii62819/afii62832/afii62803/afii62809/afii62765 /afii62822/afii62765 /afii62770/afii62832/afii62774 /afii62764/afii62761 /afii62782/afii62772/afii62766/afii62817/ اafii62767/afii62775/afii62772/afii62823 . /afii62780/afii62771/ أنو afii62833/afii62761 /afii62825/afii62832/afii62765/وafii62782/afii62761 /يafii62829/afii62766/afii62785/afii62820 / ٣٥ afii62780/afii62811
/afii62764/afii62762/afii62785/afii62824/afii62761 /afii62795/afii62809/afii62778/afii62823/ ٥٩ا afii62764/afii62757/afii62760/afii62821/afii62817/afii62760/afii62761 /afii62833/afii62785/وآafii62780/afii62818/afii62817 /afii62760/afii62831/afii62841/afii62778/afii62817/ض اafii62782/afii62803/afii62765 /afii62825/afii62820 /مafii62760/afii62831/ أafii62764/afii62768/afii62841/afii62768 /afii62780/afii62803/afii62761 /afii62825/afii62818/afii62832/afii62815/afii62832/afii62784 /afii62760/afii62761/afii62829/afii62775/afii62791/afii62820 /afii62816/afii62817/ن ذafii62760/جوآ afii62760/afii62766/afii62823/afii62756/afii62761
/afii62825/afii62832/afii62765/وafii62782/afii62762/afii62817/ا afii62782/afii62794/afii62777/afii62836/ن . ا afii62760/آ afii62782/afii62832/afii62768/afii62754/afii62766/afii62817/ ا afii62833/afii62785/وآafii62780/afii62817/د اafii62829/afii62771/afii62829/afii62761 /afii62798/afii62762/afii62765/afii62782/afii62820/ وafii62760/afii62832/afii62766/afii62811/و afii62825/afii62818/afii62832/afii62815/afii62832/afii62784 /afii62832/afii62774 /afii62770 /afii62833/afii62761 /afii62825/afii62832/afii62765/وafii62782/afii62761 /اafii62780/afii62761 /ر ٣٥ afii62829/afii62827/afii62800/afii62817/ اafii62833/afii62808
/ازafii62829/afii62820 /ءafii62760/afii62809/afii62766/afii62777/ اafii62833/afii62808 /afii62760/afii62761/afii62829/afii62775/afii62791/afii62820 /afii62760/afii62832/afii62772/afii62831/رafii62780/afii62765 /afii62825/afii62832/afii62765/وafii62782/afii62762/afii62817/ اafii62833/afii62808 /afii62782/afii62794/afii62777/afii62836/ ا afii62780/afii62803/afii62761 /afii62764/afii62817/ ا إزا afii62833/afii62785/وآafii62780/afii62817 /afii62825/afii62818/afii62832/afii62815/afii62832/afii62784 .

Similar Posts

  • CUPRINS I. PARTEA… [610431]

    CUPRINS I. PARTEA I……………………………………………………………………………………………………………………………………………………… 4 I.1. INTRODUCERE……………………………………………………………………………………………………………………………………….. 4 I.2. NOȚIUNI GENERALE-STADIUL ACTUAL AL CUNOȘTINȚELOR ÎN DOMENIU……………………………………5 I.2.1 Bolile cardiovasculare………………………………………………………………………………………………………………………..5 I.2.2 Epidemiologia bolilor cardiovasculare……………………………………………………………………………………………..6 I.2.3 Factorii de risc cardiovascular…………………………………………………………………………………………………………..6 I.2.4 Bolile metabolice………………………………………………………………………………………………………………………………..8 I.3 DIABETUL ZAHARAT…………………………………………………………………………………………………………………………….10 I.3.1 Definiție……………………………………………………………………………………………………………………………………………..10 I.3.2 Epidemiologia diabetului zaharat…………………………………………………………………………………………………..10 I.3.3 Etiopatogenia diabetului zaharat……………………………………………………………………………………………………12 I.3.4 Clasificarea etiologică a diabetului zaharat…………………………………………………………………………………..13 I.3.5 Etiologia diabetului zaharat de…

  • Varianta Finală Licenţă [628321]

    10CAPITOLULI: BIOGRAFIALUIGEORGEBACOVIA -Prezentaregenerală– Înziuade4septembrie1881,înBacău,într-ozi detoamnăcu„ceruldeplumb”1,vinepelumepoetulGeorgeBacovia,încasa comerciantuluiDimitrieVasiliușiaZoeiVasiliu. „Zoesupravegheacumultădragosteșirăbdarecreștereașieducația copiilorei,acordândînsăceamaimaredragoste,fiuluieiGheorghe-Iorguț,cum îispuneauînfamilie.”2 Lavârstadeșaseani,mergealagrădinițadecopiidinBacău,undeînvăța limbagermanășipentrucas-aîmbolnăvitnuapututfiînscrislașcoalaprimară cândîmplineașapteani. Înanul1889amerslaȘcoalaDomneascănr.1,unpensiondinBacăușiera celmaicuminteșităcutcopildinclasă.ÎntoateclaseleaobținutpremiulI. Înanul1894,1iulieprimeștediplomadeabsolvireacursuluiprimar. Înanul1899,aparepoezia„Amurgviolet”: 1AgathaGrigorescuBacovia,Bacovia,EdituraPentruLiteratură,București,1962,p.5. 2Ibidem,p.10. 11„Amurgdetoamnăviolet… Doiplopi,înfundaparînsiluete Orașuletotviolet. –Apostoliinodăjdiiviolete– Amurgdetoamnăviolet… Pedrume-olumeleneșa,cocheta; Mulțimeatoatăparevioletă, Orașultoteviolet. Amurgdetoamnăviolet… Dinturn,pecâmp,vădvoievozicuplete; Străbuniitrecînpâlcuriviolete, Orașultoteviolet.”1 Aceastăpoezieîșiareoriginileîntr-oîntâmplaredinviațadecopila autorului.Lavârstade12-13anieraatrasdeplimbărilepeMalurileBistriței,era uimitdepeisajulînamurgirecesevedeadinturnulbisericiiPrecista.Într-odupă- amiazăpecândtânărulerafermecatdeglasulclopotelorșideminunilezorilorpe înserate,paracliserulnu-lobservăpemicuț,încuieclopotnița,iaracestarămâne încuiatfărăaaveavreocaledeieșire.Înfelulacestaelseinspirădinminunata priveliște,adoarmeșiestegăsitziuaurmătoaredupăcemamaluiestefoarte îngrijoratădedisparițianeașteptatăaluiIorguț. OaltăpoeziecareaveasăaparăsubsemnultristețiidinfamiliaBacoviaera inspiratădindramace-otrăiasoraacestuiaVirginia,careseîmbolnăvisegrav 1GeorgeBacovia,Poezii,VolumulPlumb,EdituraMinerva,București,1980 12nemaiputândsăurmezeșigradulIIlașcoalaprofesionalădinBacău.Versurile scrisedepoetînpoezia„Amurgdevară”suntreprezentativepentrudramatraită deacesta: „Histerizatefecioarepale… Laferestredeschise,palpită… Înamurguriroșii,nupțiale, Staupale,șinusemaimărită. Eutrec,îmbătrânit,cașiele, Și-asemeneainimameaplânge- Dintreacăt,tuturor,înperdele Lepuncâte-orazadesânge…”1 Înanul1903scriepoezia„Searătristă”porninddelaversul„Barbarcânta femeia-aceea”,inspiratdin„cânteculprimitivaluneicântărețece-ijigniseauzul, darîlmișcasemulttristețeacucarecântase”2:…

  • Capătă Andreea Măriuca Femeia, Victima Violenței Domestice 2019 [621590]

    Universitatea din București Facultatea de sociologie și asistență socială FEMEIA, VICTIMA VIOLENȚEI DOMESTICE Comunicare și redactare Capătă Andreea -Măriuca Sociologie, seria 1 grupa 2, -2019 O problemă cu care se confruntă societate în ziua de astăzi ,dezbătută din punct de vedere sociologic o reprezintă violența domestică. În această lucrare mă voi axa pe cauzele ce…

  • PROGRAMUL DE STUDII DE LICENT  A LUCRARE DE LICENT  A COORDONATOR: ABSOLVENT: Lect. Dr. Moleriu Radu Nicoleta Maria TIMIS OARA 2020… [611970]

    UNIVERSITATEA DE VEST DIN TIMIS OARA FACULTATEA DE MATEMATIC A S I INFORMATIC A PROGRAMUL DE STUDII DE LICENT  A LUCRARE DE LICENT  A COORDONATOR: ABSOLVENT: [anonimizat] OARA 2020 UNIVERSITATEA DE VEST DIN TIMIS OARA FACULTATEA DE MATEMATIC A S I INFORMATIC A PROGRAMUL DE STUDII DE LICENT  A ELEMENTE DE STATISTIC…

  • ACCIDENTE VASCULARE CEREBRALE – ASPECTE ANATOMO -IMAGISTICE ȘI IMPLICAȚII CLINICE Coordonator Științific ȘEF LUCRĂRI DR. CRISTEA BOGDAN MIHAI… [631599]

    UNIVERSITATEA DE MEDICINĂ ȘI FARMACIE “CAROL DAVILA” BUCURE ȘTI FACULTATEA DE MEDICINĂ LUCRARE DE LICENȚĂ ACCIDENTE VASCULARE CEREBRALE – ASPECTE ANATOMO -IMAGISTICE ȘI IMPLICAȚII CLINICE Coordonator Științific ȘEF LUCRĂRI DR. CRISTEA BOGDAN MIHAI Ȋndrumător Științific ȘEF LUCRĂRI DR. CRISTEA BOGDAN MIHAI Absolvent: [anonimizat] 2019 2 CUPRINS INTRODUCERE…… ………………………………… ………………… ………3 PARTEA GENERALĂ……………………………… ……………………… ….4 Configurația…