Postharvest Biology and Technology 87 (2014) 7078 [600791]

Postharvest Biology and Technology 87 (2014) 70–78
Contents lists available at ScienceDirect
Postharvest Biology and Technology
journal h om epa ge : www.elsevier.com/locate/postharvbio
Pre-harvest calcium application increases biomass and delays
senescence
of broccoli microgreens
Liping Koua,b, Tianbao Yangb,∗, Yaguang Luob, Xianjin Liub,c, Luhong Huangb,d,
Eton Codlinge
aCollege of Food Science and Engineering, Northwest A&F University, Yangling, Shaanxi 712100, China
bFood Quality Laboratory, Beltsville Agricultural Research Center, Agricultural Research Service, US Department of Agriculture, 10300 Baltimore Avenue,
Beltsville, MD 20705, USA
cInstitute of Food Safety, Jiangsu Academy of Agricultural Sciences, Nanjing, Jiangsu 210014, China
dHunan Agricultural Product Processing Institute, Hunan Academy of Agricultural Sciences, Changsha, Hunan 410125, China
eEnvironmental Management and Byproduct Utilization Laboratory, Beltsville Agricultural Research Center, Agricultural Research Service, US Department
of
Agriculture, 10300 Baltimore Avenue, Beltsville, MD 20705, USA
a r t i c l e i n f o
Article history:
Received
24 January 2013
Accepted
3 August 2013
Keywords:Fresh-cutModified atmosphere packaging
Postharvest
quality
Shelf
life
Antioxidant
enzyme
Senescence
associated genea b s t r a c t
Microgreen consumption has been steadily increasing in recent years due to consumer awareness of their
unique color, rich flavor, and concentrated bioactive compounds. However, industrial production and
marketing is limited by their short shelf-life associated with rapid deterioration in product quality. This
study investigated the effect of pre-harvest calcium application on the post-harvest quality and shelf-
life of broccoli microgreens. Broccoli microgreen seedlings were sprayed daily with calcium chloride
at concentrations of 1, 10 and 20 mM, or water (control) for 10 days. The fresh-cut microgreens were
packaged in sealed polyethylene film bags. Package headspace atmospheric conditions, overall visual
quality and tissue membrane integrity were evaluated on days 0, 7, 14, and 21, during 5◦C storage.
Results indicated that the 10 mM calcium chloride treatment increased the biomass by more than 50%,
and tripled the calcium content as compared to the water-treated controls. Microgreens treated with
10 mM calcium chloride spray exhibited higher superoxide dismutase and peroxidase activities, lower
tissue electrolyte leakage, improved overall visual quality, and reduced microbial growth during storage.
Furthermore, calcium treatment significantly affected expression of the senescence-associated genes
BoSAG12, BoGPX6, BoCAT3 and BoSAG12. These results provide important information for commercial
growers to enhance productivity and improve postharvest quality and shelf-life, potentially enabling a
broadening of the retail marketing of broccoli microgreens.
Published by Elsevier B.V.
1. Introduction
Microgreens are young and tender cotyledon greens harvested
within 7–14 d of vegetable seedling emergence. In recent years,
consumption of microgreens has increased along with consumer
awareness and appreciation for their tender texture, distinctive
fresh flavors, and concentrated bioactive compounds, such as
vitamins, minerals, antioxidants, etc., as compared to mature leafy
greens (Chandra et al., 2012; Kou et al., 2013; Xiao et al., 2012 ).
Thus they are considered to be “functional foods”, which contain
health-promoting or disease-preventing properties beyond the
basic function of supplying nutrients (Xiao et al., 2012 ). For exam-
ple, broccoli (Brassica oleracea L. var. italica ) is a very important
economic dietary crop for consumption of both florets and young
∗Corresponding author. Tel.: +1 301 504 6635; fax: +1 301 504 5107.
E-mail address: tianbao.yang@ars.usda.gov (T. Yang).seedlings. They are highly prized for their health benefits, as they
are rich in vitamins, trace elements, amino acids, antioxidants,
protein, etc. (Fahey et al., 1997; Finley et al., 2001; Han et al.,
2006 ). Broccoli sprouts contain about 50 times more sulfurophane
by weight than mature broccoli (Mewis et al., 2012 ). However,
microgreen consumption is limited by their low productivity, rapid
senescence and a very short shelf life, usually 3–5 d at ambient
temperature (Chandra et al., 2012; Kou et al., 2013 ).
Accumulated evidence has shown that calcium plays a pivotal
role in plant growth, development and response to external and
internal signals (Kudla et al., 2010; Poovaiah and Reddy, 1987;
Reddy, 2001 ). Calcium treatment was also found to have a ben-
eficial effect on the storage of fruits and vegetables by retarding
fruit ripening and leaf senescence (Holb et al., 2012; Martin-Diana
et al., 2007; Poovaiah and Leopold, 1973 ). It has been suggested that
calcium can retard ripening and senescence by crosslinking with
pectic polymers in cell wall (Liu et al., 2009 ) and protecting cell
membrane integrity (Cheour et al., 1992; Guimaraes et al., 2011 ).
0925-5214/$ – see front matter. Published by Elsevier B.V.
http://dx.doi.org/10.1016/j.postharvbio.2013.08.004

L. Kou et al. / Postharvest Biology and Technology 87 (2014) 70–78 71
However, the molecular mechanism for calcium action in delaying
plant senescence is not clear. Senescence in plants is a complex
but highly regulated process (Breeze et al., 2011; Guo and Gan,
2012; Lim et al., 2007 ). For normal plant organs, senescence is
a natural development and age-dependent deterioration process
leading to programmed cell death. The changes in senescence-
associated gene expression patterns in tissues occur well before
any visible signs of senescence are observed. These genes include
SAG12 , GPX6 , CAT3 and EIN3 which are involved in protein degra-
dation, oxidative stress and ethylene signal transduction pathway
(Buchanan-Wollaston and Ainsworth, 1997; Li et al., 2012; Page
et al., 2001 ). As compared to fruits and mature green leaves, fresh-
cut microgreens harvested in the very early stage are very tender
and subjected to much more stress leading to rapid senescence and
a very short shelf-life. The physiological, biochemical and molecular
events occurring during microgreen storage deserve more atten-
tion, since most studies have focused on the postharvest changes
in mature fruit tissues and mature leaves that senesce more slowly.
Here we report the effects of pre-harvest application of calcium on
broccoli microgreen yield, senescence and postharvest quality.
2. Materials and methods
2.1. Plant materials and treatments
Broccoli seeds were obtained from Living Whole Foods
Inc. (West Springville, USA). Hydroponic ‘Sure to grow’ pads
(0.208 m × 0.254 m, Growers Supply, USA) were set evenly in
0.54 m × 0.28 m × 0.06 m trays (vacuum-formed standard 1020
open flats) containing 600 mL water (pH 5.6 acidified water). The
seeds were then spread evenly over the damp pad. The trays
were kept in a growth chamber at 25◦C in the dark for 4 d
after seed sowing before exposing to light with the light intensity
of 42 /H9262mol s−1m−2for 12 h/12 h (light/dark). The seedlings were
sprayed on a daily basis for 10 d with H2O (pH 5.6) only, 1 mM,
10 mM, and 20 mM CaCl 2or MgCl 2or 5 mM EGTA (Sigma–Aldrich,
USA). Microgreens, including hypocotyl and cotyledons, were har-
vested on 10 d after sowing (harvest day) by cutting near the bottom
of each hypocotyl with a pair of sterilized scissors. Microgreens
with no obvious damaged hypocotyl and cotyledons were used for
all postharvest analyses.
2.2. Total calcium content
Calcium content was measured as described (Codling et al.,
2007 ). Briefly, the harvested microgreens were rinsed three times
with double distilled water to remove any surface calcium before
drying in 70◦C oven for 48 h. Oven-dried ground plant tissues
(0.002 kg) were ashed at 550◦C for 16 h, followed by the addition
of 2 mL concentrated nitric acid (trace element grade); samples
were then brought to dryness on a hot plate. After drying, 10 mL
of 3 M HCl were added and the mixtures were allowed to reflux for
2 h. The digests were filtered through Whatman #40 filter paper
and the filtrate volumes were brought to 25 mL with 0.1 M HCl.
Calcium concentration in the tissue was determined using Optima
4300 DV Inductively Coupled Plasma Optical Emission Spectrome-
ter (PerkinElmer, USA) with strontium as an internal standard. For
quality control, one blank and one peach leaves standard from the
National Institute of Standards were added for every 10 samples.
2.3. Postharvest package and storage
The fresh-cut broccoli microgreens (0.01 kg each) were pack-
aged in sealed bags (0.1 m × 0.1 m) prepared with polyethylene
films of 16.6 pmol s−1m−2Pa−1oxygen transmission rate (OTR).
Samples were stored at 5◦C for 21 d. Quality evaluations wereperformed on 0, 4, 7, 14 and 21 d postharvest (DPH). Antioxidant
associated enzyme activities were measured on 0, 7 and 14 DPH.
2.4. Postharvest quality and plant physiology assessment
The CO 2and O2in the headspace of packages containing fresh-
cut microgreens were measured using a gas analyzer (Check mate
II, PBI Dansensor Co., Denmark) by inserting the needle of the mea-
suring assembly through a septum adhered to the packaging film
and into the package headspace.
Sensory quality attributes of off-odor and overall visual qual-
ity were evaluated by a highly-trained panel (members had either
more than seven-year sensory experience or intensive training and
experience in sensory analysis of microgreens) immediately after
opening the bags following a modified procedure (Luo et al., 2004 ).
Off-odor was scored on an 1–5 scale, where 1 = no off-odor and
5 = extremely strong off-odor. Overall quality was evaluated with a
9-point hedonic scale, where 9 = like extremely, 5 = neither like nor
dislike and 1 = dislike extremely (Meilgaard et al., 1991 ).
Tissue electrolyte leakage was measured following a modified
procedure (Kim et al., 2005 ). Fresh broccoli microgreens (0.003 kg)
were submerged in 150 mL aliquots of distilled water at 5◦C for
30 min. The electrical conductivity of the solution was measured
using a conductivity meter (model 135A; Orion Research Inc., USA).
Total sample conductivity was determined on the same treatments
after freezing at −20◦C for 24 h and subsequent thawing. Tissue
electrolyte leakage was expressed as a percentage of the total con-
ductivity.
2.5. Postharvest microbiological quality assessment
Each sample (0.003 kg) were macerated in 27 mL 1× PBS (phos-
phate buffered saline) using a model 80 Lab Stomacher (Seward
Medical, UK) for 120 s at high speed in filtration stomacher bags. A
50 /H9262L sample of each filtrate or its appropriate dilution was loga-
rithmically spread on agar plates with an automatic spiral plater
(Wasp II, Don Whitley Scientific Ltd., UK). Enumeration of the
total aerobic mesophilic bacteria were plated on tryptic soy agar
(TSA, Difco Lab, USA) and incubated at 30◦C for 24–48 h. Microbial
colonies were counted using an automated colony counter (Proto-
COL SR; Synoptics, UK) and reported as log CFU mL−1of tissue.
2.6. Assessment of antioxidant enzyme activity
Antioxidant enzymes peroxidase (POD), superoxide dismutase
(SOD), and catalase (CAT) were extracted and analyzed as described
(Havir and McHale, 1987; Lurie et al., 1997; Prochazkova et al.,
2001 ). Briefly, 0.004 kg samples were homogenized in 10 mL pH 7.8,
50 mM PBS, containing 1% (w/v) polyvinylpolypyrolidone (PVPP)
and 1 mM EDTA, then centrifuged at 10,000 × g for 20 min at 4◦C.
The supernatant was collected for POD, SOD, and CAT assay. The
POD activity was expressed as U (unit) kg−1, on a fresh weight
basis, where U = 0.01 /SOH absorbance 470 s−1. The CAT activity was
expressed as U kg−1, on a fresh weight basis, where U = 0.1 /SOH
absorbance 240 s−1, and the SOD activity was expressed as U kg−1,
on a fresh weight basis. The volume of enzyme corresponding to
50% inhibition of nitro-blue tetrazolium (NBT) reduction at 560 nm
was considered as one enzyme unit.
2.7. RT-qPCR
Total RNA was isolated from frozen tissue using the RNeasy
Plant Mini Kit following the manufacturer’s instructions (Qiagen,
USA). One /H9262g of total RNA was used to synthesize cDNA with the
oligo-(dT) 18primer following the instructions of the Superscript III
kit (Invitrogen, USA). Quantitative Real-Time PCR (qPCR) analysis

72 L. Kou et al. / Postharvest Biology and Technology 87 (2014) 70–78
Table 1
Genes
and oligonucleotides used in qPCR experiments.
Gene name GenBank no. /Brassica Database Arabidopsis ortholog Primer pairs (sense/antisense)
BoSAG12 HQ840430/Scaffold000249 At5g45890 tagaaggaggtggttttgatttcc/aatcctcatgtatccaccttctcc
BoGPX6
AJ293420/Scaffold000249 At4g11600 ccattttcgacaaggttgatgt/gaggagaagtggttggagcgta
BoCAT3 /C05#2011-08-02#BGI At1g20620 tggaagcttttcatccagacaa/agcaagctgctcagtttcattg
BoEIN3 /C05#2011-08-02#BGI At3g20770 gcttgcaggataagatgactgcta/agtctccttctccaaaccatcaac
BoACT2
/C03#2011-08-02#BGI At3g18780 aggagatggagacttccaaaacc/gtccttcctgatatccacgtcac
of cDNA was performed on a CFX96 Real-Time System (Bio-RAD,
USA) with gene specific primers. The gene specific primers were
based on the broccoli genomic sequence from Brassica Database
(http://brassicadb.org ) after aligning with Arabidopsis ethylene
signaling gene EIN3 , senescence marker gene SAG12 , phospholipid
hydroperoxide glutathione peroxidase GPX6 , catalase CAT3 , and
house-keeping gene ACT2 . The primers for those genes used are
listed in Table 1. The nucleotide sequences of the amplified frag-
ments were confirmed by DNA sequencing. Gene expression levels
were measured by RT-qPCR as described (Yang et al., 2012 ). Briefly,
relative quantification of specific mRNA levels was analyzed using
the cycle threshold (Ct) 2−/Delta1/Delta1 Ctmethod. Relative expression levels
were normalized using the housekeeping gene actin and shown
in percentage (highest value = 100%). Student’s t test (P0.05 ) was
used to determine the significant difference of relative expression
of individual genes among non-treatment and different treatments
(Microsoft Excel 2007, USA).
2.8. Statistical analysis
Package atmospheres, tissue electrolyte leakage, overall quality
and off-odor, microbial data and enzyme assays were analyzed as
two-factor linear models using the PROC MIXED procedure (SAS
Institute Inc. 1999, Cary, NC). The two factors were storage time
with 4 or 5 levels and calcium treatment with 4 levels. Quality
and off-odor evaluator ratings were averaged for each sample. Day
zero quality and off-odor data were not included in the analy-
sis, because values from all evaluators were the same. Package
atmosphere data also excluded day zero analysis. Different sam-
ples were analyzed on each evaluation day for all parameters. Four
replications (four bags) were examined per treatment per evalua-
tion period. Calcium content, hypocotyl length and dry and fresh
weight analyses were analyzed as 1 factor models with treatment as
the only factor. Assumptions of normality and variance homogene-
ity of the linear model were checked for all analyses. Electrolyte
leakage and microbial data were natural log transformed and com-
mon log transformed, respectively, to meet the assumption of
normality. The variance grouping technique was used to correct for
variance heterogeneity. When effects were statistically significant,
means were compared using Sidak adjusted p-values to maintain
experiment-wise error ≤0.05.
3. Results
3.1. Effects of calcium treatment on microgreen yield and calcium content
To investigate the effect of calcium on plant growth and yield, we measured the
hypocotyl
length on 10 d after seed sowing. Ten mM CaCl 2significantly promoted
broccoli
hypocotyl length (P < 0.0001) (Fig. 1). The hypocotyl length of 10 mM CaCl 2
treated microgreens was 0.071 m, while the hypocotyl of water-treated seedlings
was
only 0.056 m. Furthermore, 10 mM CaCl 2treated seedlings had larger and more
fully
expanded cotyledons than those of water only control (Fig. 2A). However, 1
and 20 mM CaCl 2treatments did not show obvious growth promoting effect. More-
over,
20 mM treatment resulted in yellow cotyledons (data not shown). These results
suggest
that the dosage of calcium is important for the growth stimulation, and too
much
calcium application may have the adverse effect on growth. Further, broccoli
seedlings
were sprayed with 5 mM EGTA, a calcium chelator, and different concen-
trations
of MgCl 2. EGTA treated broccoli exhibited the shortest hypocotyl (0.045 m)
on
10 d after seed sowing (Fig. 1). All MgCl 2treated broccoli were shorter thanwater-treated control, too (Fig. 1). All together, our results indicated that calcium
was the only factor to promote hypocotyl elongation.
On
harvest day, the microgreens sprayed with 10 mM CaCl 2were 10 kg and
0.62
kg from one kilogram seeds, respectively. In contrast, the microgreens sprayed
with
water only weighed 6.5 kg (fresh weight) and 0.5 kg (dry weight) from one
kilogram
seeds. Thus 10 mM CaCl 2treatment increased microgreen yield by 53.8%
based on fresh weight and 24.4% based on dry weight, respectively (Figs. 2B and
C).
However, 1 and 20 mM CaCl 2treatments did not have the significant effect on
microgreen
yield as compared to water-treated control (data not shown). Further,
microgreens
treated with 10 mM CaCl 2contained over 160% more calcium than
those sprayed with water alone (Fig. 2D). These results demonstrated that 10 mM
CaCl 2treatment significantly increased both microgreen productivity and calcium
content
(P = 0.0007).
3.2. Effects of calcium treatment on broccoli microgreen postharvest traits
Fig. 3A and B shows the headspace oxygen and carbon dioxide partial pressures,
respectively, in the packages of calcium-treated and water-treated samples during
storage
(Fig. 3A). During the 21 d of storage, oxygen partial pressures in water con-
trol packages decreased rapidly from 21.0 kPa to 0.6 kPa on d 4, and continuing to
decline
steadily to 0 on d 21. This was followed by 1 mM CaCl 2treatment packages
which
decreased to 0.9 by d 7 and then held steady at that level until after d 14,
finally
declining to 0.1 on d 21. Oxygen partial pressures in 10 and 20 mM CaCl 2
treatment packages decreased at a much slower rate, from 21.0 kPa to 3.5 kPa and
1.8 kPa, respectively on d 21 of storage. The CO 2partial pressures in all treatments
increased
sharply from d 0 through d 4. However, from d 4 through 21, there were
no
significant differences among CO 2partial pressures for different treatments and
between
treatments and control (Fig. 3B).
Further
we examined the overall visual quality (Fig. 4A) and off-odor (Fig. 4B) for
each treatment. All calcium-treated samples retained superior quality over water-
treated
samples from d 7 of storage. The 10 mM CaCl 2-treated samples had the least
off-odor
observed from d 7 until the end of storage and highest overall visual quality
observed
from d 14 until the end of storage with respective scores of 0.8 and 5.3 on
d
21. In comparison, water-treated seedlings yielded an off-odor score of 3.8 and
an overall quality score of 2.7 on d 21. The results indicated that the microgreens
treated
with 10 mM CaCl 2retained the best postharvest quality and the longest shelf
life.
Tissue
electrolyte leakage (EL) was closely related to the quality and shelf life
of
fresh-cut produce (Allende et al., 2004; Luo et al., 2004 ). There was a significant
Fig. 1. Hypocotyl length of broccoli seedlings on harvest day (10 d after seed sow-
ing).
Different concentrations of CaCl 2or MaCl 2or 5 mM EGTA were sprayed on
broccoli
seedlings once a day. Data presented are the means of four replications;
Different
letters (a–d) indicate significant differences between treatment means at
˛
= 0.05.

L. Kou et al. / Postharvest Biology and Technology 87 (2014) 70–78 73
Fig. 2. Broccoli microgreens images (A), fresh weight (B), dry matter (C) and total calcium content (D) on harvest day (10 d after seed sowing). Ten day old seedlings were
harvested
by cutting above the root with sterilized scissors, and microgreen fresh weight and dry matter from one kilogram seeds were measured as kg kg−1. Total calcium
content
was measured from 0.1 kg microgreens based on fresh weight. Data presented are the means of four replications. Different letters (a and b) indicate significant
differences
between treatment means at ˛ = 0.05.
(P < 0.001) decrease in EL among all treatments except for 1 mM calcium from 0
to
4 DPH (Fig. 5A) probably due to tissue damage incurred to stems during har-
vesting,
followed by a period of recovery. A similar phenomenon was found for
buckwheat
microgreens and edible flowers (Kou et al., 2012, 2013 ). Already, byd 4, EL for 10 mM calcium treatment was significantly lower (P < 0.001) than that
of
other treatments and remained lower through the end of storage (P < 0.01).
Electrolyte
leakage increased to 34% by 21 DPH for microgreens that did not
receive
calcium spray treatment. Microgreens that received 1 mM and 20 mM CaCl 2

74 L. Kou et al. / Postharvest Biology and Technology 87 (2014) 70–78
Fig. 3. O2(A) and CO 2(B) of broccoli microgreens after 0, 4, 7, 14 and 21 d of storage
at 5◦C. Data presented are the means of four replications; vertical lines represent
standard
errors.
treatments exhibited a smaller increase in EL to 17% and 14%, respectively. Impor-
tantly, EL in 10 mM CaCl 2-treated microgreens increased only to 4% by d 21.
Pre-harvest
calcium treatment had significant (P < 0.0001) effect on total aero-
bic
mesophilic bacterial growth (Fig. 5B). Microgreens treated with calcium chloride
had significantly (P < 0.0001) lower bacterial counts than those sprayed with water at
the
end of storage. In particular, 10 mM CaCl 2-treated microgreens had significantly
lower
(P < 0.0001) total aerobic mesophilic bacterial counts than the control from d
4
through d 21 and the lowest total aerobic mesophilic bacterial (8.7 log CFU mL−1)
counts
of all treatments on d 21. The mean total aerobic mesophilic bacterial plate
count
for water-treated microgreens was more than 1.5 log higher than that for
10
mM calcium-treated microgreens at the end of storage. Others reported sim-
ilar
effects of CaCl 2on bacterial growth on honeydew melon, sweet cherry and
strawberry
fruits (Ippolito et al., 2005; Saftner et al., 2003 ).
3.3. Calcium-treated microgreens had high antioxidant activity
Since 10 mM CaCl 2treated microgreens exhibited the best postharvest quality,
this
concentration of CaCl 2was chosen to study its effects on the antioxidant enzyme
activity
and gene expression in microgreens. Catalase activity slightly increased in
both
calcium- and water-treated microgreens during first 7 d, and then declined
slightly
in calcium-treated samples (Fig. 6A), but continued to increase gradually in
the control samples during the following 7 d. Overall, CAT activity during storage
was
not significantly affected by calcium treatment.
Superoxide
dismutase activity was found to be significantly (P < 0.0001) higher
in
calcium-treated microgreens than in controls (Fig. 6B). SOD activity decreased
for
both treatments during the first 7 days of storage, but continued to decline in
controls while remaining stable in calcium-treated samples over the following 7
days.
However, SOD activity for calcium-treated microgreens was consistently sig-
nificantly
higher than that of water-treated controls (more than 3 fold on d 0, more
than
5 fold on d 7, and more than 10 fold on d 14).
Peroxidase
activity for calcium-treated microgreens was approximately 2.4
times
greater than that of water-treated samples on 0 and 7 DPH (Fig. 6C). Peroxidase
activities
remained stable for calcium-treated microgreens while they increased
dramatically
in controls after 7 DPH. However, on day 14 POD activity for calcium-
treated
microgreens remained 1.4 times higher than that for controls. These results
indicated
that calcium-treatment significantly increased SOD and POD activities
(P
< 0.0001).
Fig. 4. Off-odor (A) and overall quality (B) of broccoli microgreens after 0, 4, 7, 14
and
21 d of storage at 5◦C. Data presented are the means of four replications; vertical
lines
represent standard errors.
3.4. Calcium treatment affects senescence-associated gene expression
The relative mRNA levels of four selected senescence-associated genes in micro-
greens
during storage were examined using RT-qPCR (Fig. 7). The expressions of
all
those gene expression were increased after storage. Dramatic inductions were
detected
for BoSAG12 , BoGPX6 and BoCAT3 , which had more than 10 fold increase
in
the mRNA level for both calcium-treated and water only control after four days
storage. Except BoCAT3 , all other genes showed the significantly low expression in
calcium-treated
samples as compared to the water treated alone, especially from d 0
to
d 14 during storage. Overall, the gene mostly affected by calcium was BoGPX6 , and
its
expression in calcium-treated sample on 0, 4, 7 and 14 DPH was about 49%, 19%,
42%
and 34%, respectively, of the water treated sample. The following was BoSAG12 ,
and its expression in calcium-treated sample on 0, 4, 7 and 14 DPH was about 23%,
40%,
60% and 83%, respectively, in the water only treated sample, indicating that the
calcium
inhibition on BoSAG12 was gradually slowed down. Last, the expression of
BoEIN3
in calcium-treated sample on 0, 4, 7 and 14 DPH was about 69%, 64%, 51%
and
46%, respectively, in the water only treated sample, suggesting that calcium had
the
negative impact on the ethylene signaling. However, calcium treatment did not
show
obvious effect on BoCAT3 expression at all the stages examined.
4. Discussion
Low yield and short shelf life are two major limiting factors
for microgreen industry (Chandra et al., 2012; Kou et al., 2013 ).
This study demonstrates that calcium application can significantly
increase broccoli microgreen yield, improve postharvest quality
and extend the shelf life. In addition, the calcium content in
calcium-treated microgreens has been significantly increased. This
can enhance the consumer appreciation due to the benefits of cal-
cium to human health (Gras et al., 2003 ).
It is intriguing that calcium increases broccoli biomass over
50%, mainly by promoting hypocotyl elongation (Figs. 1 and 2).
The hypocotyl growth rate and length are determined largely by

L. Kou et al. / Postharvest Biology and Technology 87 (2014) 70–78 75
Fig. 5. Tissue electrolyte leakage (A) and aerobic mesophilic bacteria (B) of broccoli
microgreens
after 0, 4, 7, 14 and 21 d of storage at 5◦C. Data presented are the means
of four replications; vertical lines represent standard errors.
cell elongation. Cell elongation is influenced by external cues such
as light, temperature, and phytohormones such as auxin and gib-
berilic acids (Chapman et al., 2012; Collett et al., 2000; Kurepin
et al., 2012; Moll and Jones, 1981 ). Calcium has been shown to
affect cell elongation, too. However the exact role of calcium on
the cell elongation is controversial. On the one hand, calcium was
shown to inhibit cell elongation. This inhibitory effect was initially
explained with a decrease in extensibility of the tissue due to the
consequence of bridging between pectic carboxy groups in the cell
wall, or the calcium inhibition of the biochemical wall-loosing pro-
cess (Cleland and Rayle, 1977 ). Recently, calcium was suggested to
inhibit hypocotyl elongation by destabilizing cortical microtubules
via regulating a microtube-destabilizing protein, MDP25 (Li et al.,
2011 ). On the other hand, calcium was shown to stimulate auxin
responsive gene expression, and promote cell elongation in wheat
(Singla et al., 2006 ). The calcium chelator EGTA and calcium chan-
nel blockers inhibited the auxin-induced cell elongation and auxin
responsive genes (Reddy et al., 1988 ). Our results indicate that cal-
cium effect on cell elongation is dosage dependent. Ten mM CaCl 2
treatment exhibited the promotion of broccoli hypocotyl elonga-
tion. However, high doses of calcium application (20 mM CaCl 2)
showed the adverse effect on hypocotyl growth. Calcium in cytosol
acts as a ubiquitous second messenger to regulate diverse cellu-
lar processes in plants by conveying signals received at the cell
surface to the inside of the cell through spatiotemporal concentra-
tion changes that are decoded by an array of Ca2+sensors (Kudla
et al., 2010; Reddy, 2001; Yang and Poovaiah, 2003 ). At the nor-
mal situation, cytosolic calcium concentration is well controlled
through calcium influx and calcium efflux mechanism in cell mem-
brane (White and Broadley, 2003 ). However, too much calcium
application could affect calcium influx/efflux balance, lead to the
Fig. 6. Catalase (A), superoxide dismutase (B) and peroxidase activities (C) of broc-
coli
microgreens after 0, 4, 7, 14 and 21 d of storage at 5◦C. CAT, catalase; SOD,
superoxide
dismutase; POD, peroxidase. Data presented are the means of four repli-
cations; vertical lines represent standard errors. Different letters (a and b) indicate
significant
differences between treatment means at ˛ = 0.05 on the same day.
uncontrolled cytosolic calcium concentration changes, and even-
tually cause cell damages. Further studies are needed to dissect
the molecular mechanism for calcium’s role in cell elongation and
damage.
Microgreens senesce rapidly after harvest and have a very
short shelf-life due to the sudden disruption of plant growth at
a very early stage. Rapid physiological, biochemical and molec-
ular changes have been shown to occur during leaf senescence
(Guo and Gan, 2012; Lim et al., 2007 ). Changes in gene expres-
sion patterns take place in the harvested tissue well before any
visible signs of senescence are observed. Senescence in plants
has been demonstrated to induce increased expression of certain
senescence-associated genes (Breeze et al., 2011; Guo and Gan,
2012; Li et al., 2012 ). Four typical senescence-associated genes
were selected for the expression studies during microgreen stor-
age. SAG12 encodes a Cys protease to degrade proteins, which
is expressed in senescent leaf tissue and broccoli florets during
storage (Page et al., 2001 ). BoGPX6 is a putative phospholipid
hydroperoxide glutathione peroxidase (Page et al., 2001 ) and likely
to have a role in protection against cell membrane damage resulted
from lipid peroxidation. BoCAT3 is a homolog of Arabidopsis catalase
AtCAT3 , and highly expressed in old broccoli leaves and postharvest
florets (Page et al., 2001 ). Catalase is an antioxidase which con-
tributes to the degradation of H2O2into water (Yang and Poovaiah,
2002 ). BoEIN3 is the EIN3 ortholog in Arabidopsis , a key gene
in ethylene signaling pathway which plays an important role in

76 L. Kou et al. / Postharvest Biology and Technology 87 (2014) 70–78
Fig. 7. Expression of senescence-associated genes in treated broccoli microgreens after 0, 4, 7, 14 d of storage at 5◦C. Total RNAs used for reverse transcription were isolated
from microgreens on different days post-harvest. Transcript levels of four senescence-associated genes were determined by RT-qPCR. Relative gene expression levels (highest
value
= 100%) are shown following normalization with house-keeping gene actin transcript values. For each gene, different letters indicate statistically significant differences
among mean values (P value < 0.05; t-test). The RT-qPCR analyses were repeated at least three times from two independent experiments with similar results.
regulating senescence (Li et al., 2012 ). In this study, the expres-
sions of all these genes were increased after harvest, indicating
that they were senescence-associated genes in microgreens, too. All
genes, with the exception of BoCAT3 exhibited much lower expres-
sion in calcium-treated samples than in water-treated controls
(Fig. 7). Thus calcium could retards senescence by downregulating
the expression of these senescence-associated genes.
During senescence, plant cells generate abundant reactive
oxygen species (ROS) such as hydrogen peroxide (H 2O2) and super-
oxide (O2−). Accumulation of ROS inside cell can damage various
cell components when ROS level is extremely high, or activate spe-
cific signaling pathways to scavenge ROS before they can cause
cellular damage (Alvarez et al., 1998; Orozco-Cardenas et al., 2001 ).
In plant cell, POD, CAT, and SOD are important ROS detoxification
enzymes activated by a variety of signals (Asensio et al., 2012; Han
et al., 2006; Huang et al., 2008 ). Antioxidant protection offered by
SOD and POD is important for the retention of green color in broc-
coli flower buds, and the increases in SOD, POD and CAT are likely
responses to the increases in ROS production, which could sub-
sequently have led to yellowing (Toivonen and Sweeney, 1998 ).
It has been suggested that the increases in the activities of SOD,
CAT and POD are generally a consequence of the system abil-
ity to delay senescence (Supapvanich et al., 2012; Toivonen and
Sweeney, 1998 ). Calcium has been shown to enhance the activi-
ties of antioxidant enzymes and plays a key role in the homeostasis
of ROS in plants (Lin et al., 2008 ). In this study, it was found that
SOD, POD and CAT activities were higher in 10 mM CaCl 2treatedmicrogreens than in water-treated controls during first 14 days
of storage. Among the antioxidant enzymes tested, POD had the
highest activity in broccoli microgreens, and was stimulated signif-
icantly by calcium. Calcium treatment also greatly increased SOD
activity even though SOD activity in broccoli microgreens was rel-
atively low. Other researchers have reported that catalase activity
in plants is stimulated by calcium (Costa et al., 2010; Yang and
Poovaiah, 2002 ). However, we did not detect an obvious stimula-
tion of CAT activity by calcium treatment in broccoli microgreens.
At the transcriptional level, BoCAT3 expression was also not dra-
matically affected by calcium treatment (Fig. 7). This may be the
result of the relatively low expression of catalase in young micro-
green tissue as compared to that observed in mature greens (data
not shown).
Much evidence has been provided to support the hypothe-
sis that senescence results from membrane deterioration due to
lipid peroxidation and the ensuing destabilization of the bilayer
of the cell membrane (Marangoni et al., 1996 ). Thus the genes
involved in lipid peroxidation, such as GPX6 are stimulated during
senescence in order to detoxify the fatty acid hydroperoxides and
protect cell membrane (Page et al., 2001 ). Indeed, it was observed
the increase of BoGPX6 expression during senescence. However,
BoGPX6 expression in calcium-treated sample is remarkably lower
than in water-treated control. Therefore, low BoGPX6 expression
in calcium-treated microgreens may not be the direct effect of
calcium on its transcription inhibition. Instead, it may be that by
protecting the cell membrane and lessening the damage it sustains,

L. Kou et al. / Postharvest Biology and Technology 87 (2014) 70–78 77
calcium reduces the need for BoGPX6 expression and diminishes its
induction. It was reported that calcium protected cell membrane by
binding to membrane phospholipid and stabilizing the membrane
(Cheour et al., 1992; Paliyath et al., 1984 ). It was observed that
calcium reduced the tissue electrolyte leakage during microgreen
storage (Fig. 5A). Calcium treatment significantly stimulated over-
all cellular POD activity, too (Fig. 6). This would quickly remove
peroxides including lipid peroxides, and lead to the inhibition of
BoGPX6 expression in calcium-treated microgreens.
In conclusion, we have investigated the effects of preharvest
calcium treatment on the yield and postharvest quality of broccoli
microgreens. Our results indicate that calcium application signif-
icantly increases microgreen yield and calcium content, reduces
tissue electrolyte leakage, inhibit microbial growth during storage,
and improve overall visual quality during storage. Calcium-treated
microgreens exhibit higher antioxidant activities, and increased
expression of the senescence-associated genes as compared to
water spray only control. This study demonstrates that calcium is
important to enhance both broccoli microgreen productivity and
improve postharvest quality and shelf-life.
Acknowledgements
The authors would like to thank Ernie Paroczay for assistance in
planting the microgreens and Ellen Turner for critical reading of the
manuscript. Use of a company or product name by the U.S. Depart-
ment of Agriculture does not imply approval or recommendation
of the product to the exclusion of others that may also be suitable.
This research was funded by USDA-ARS project nos. 1245-43440-
004-00D and 1245-43000-012-00D.
References
Allende, A., Luo, Y., McEvoy, J., Artés, F., Wang, C., 2004. Microbial and quality
changes in minimally processed baby spinach leaves stored under super atmo-
spheric oxygen and modified atmosphere conditions. Postharvest Biol. Technol.
33, 51–59.
Alvarez, M.E., Pennell, R.I., Meijer, P.J., Ishikawa, A., Dixon, R.A., Lamb, C., 1998.
Reactive oxygen intermediates mediate a systemic signal network in the estab-
lishment of plant immunity. Cell 92, 773–784.
Asensio, A.C., Gil-Monreal, M., Pires, L., Gogorcena, Y., Aparicio-Tejo, P.M., Moran,
J.F.,
2012. Two Fe-superoxide dismutase families respond differently to stress
and senescence in legumes. J. Plant Physiol. 169, 1253–1260.
Breeze, E., Harrison, E., McHattie, S., Hughes, L., Hickman, R., Hill, C., Kiddle, S.,
Kim, Y.S., Penfold, C.A., Jenkins, D., Zhang, C.J., Morris, K., Jenner, C., Jackson, S.,
Thomas,
B., Tabrett, A., Legaie, R., Moore, J.D., Wild, D.L., Ott, S., Rand, D., Beynon,
J., Denby, K., Mead, A., Buchanan-Wollaston, V., 2011. High-resolution tempo-
ral profiling of transcripts during Arabidopsis leaf senescence reveals a distinct
chronology of processes and regulation. Plant Cell 23, 873–894.
Buchanan-Wollaston, V., Ainsworth, C., 1997. Leaf senescence in Brassica napus :
cloning of senescence related genes by subtractive hybridisation. Plant Mol. Biol.
33, 821–834.
Chandra, D., Kim, J.G., Kim, Y.P., 2012. Changes in microbial population and quality
of microgreens treated with different sanitizers and packaging films. Hortic.
Environ. Biotechnol. 53, 32–40.
Chapman, E.J., Greenham, K., Castillejo, C., Sartor, R., Bialy, A., Sun, T.P., Estelle, M.,
2012. Hypocotyl transcriptome reveals auxin regulation of growth-promoting
genes through GA-dependent and -independent pathways. PLoS One 7, e36210.
Cheour, F., Arul, J., Makhlouf, J., Willemot, C., 1992. Delay of membrane lipid degra-
dation by calcium treatment during cabbage leaf senescence. Plant Physiol. 100,
1656–1660.
Cleland, R.E., Rayle, D.L., 1977. Re-evaluation of effect of calcium-ions on auxin-
induced elongation. Plant Physiol. 60, 709–712.
Codling, E.E., Mulchi, C.L., Chaney, R.L., 2007. Grain yield and mineral element
composition of maize grown on high phosphorus soils amended with water
treatment residual. J. Plant Nutr. 30, 225–240.
Collett, C.E., Harberd, N.P., Leyser, O., 2000. Hormonal interactions in the control of
Arabidopsis hypocotyl elongation. Plant Physiol. 124, 553–561.
Costa, A., Drago, I., Behera, S., Zottini, M., Pizzo, P., Schroeder, J.I., Pozzan, T., Schiavo,
F.L., 2010. H2O2in plant peroxisomes: an in vivo analysis uncovers a Ca2+-
dependent scavenging system. Plant J. 62, 760–772.
Fahey, J.W., Zhang, Y.S., Talalay, P., 1997. Broccoli sprouts: an exceptionally rich
source of inducers of enzymes that protect against chemical carcinogens. Proc.
Natl. Acad. Sci. U.S.A. 94, 10367–10372.
Finley, J., Ip, C., Lisk, D., Davis, C., Hintze, K., Whanger, P., 2001. Cancer-protective
properties of high-selenium broccoli. J. Agric. Food Chem. 49, 2679–2683.Gras, M.L., Vidal, D., Betoret, N., Chiralt, A., Fito, P., 2003. Calcium fortification of
vegetables by vacuum impregnation interactions with cellular matrix. J. Food
Eng. 56, 279–284.
Guimaraes, F.V.A., de Lacerda, C.F., Marques, E.C., de Miranda, M.R.A., de Abreu, C.E.B.,
Prisco, J.T., Gomes, E., 2011. Calcium can moderate changes on membrane struc-
ture and lipid composition in cowpea plants under salt stress. Plant Growth
Regul. 65, 55–63.
Guo, Y.F., Gan, S.S., 2012. Convergence and divergence in gene expression profiles
induced by leaf senescence and 27 senescence-promoting hormonal, patholog-
ical and environmental stress treatments. Plant Cell Environ. 35, 644–655.
Han, J., Tao, W., Hao, H., Zhang, B., Jiang, W., Niu, T., Li, Q., Cai, T., 2006. Physiology and
quality responses of fresh-cut broccoli florets pretreated with ethanol vapor. J.
Food Sci. 71, S385–S389.
Havir, E., McHale, N., 1987. Biochemical and developmental characterization of mul-
tiple
forms of catalase in tobacco leaves. Plant Physiol. 84, 450–455.
Holb, I.J., Balla, B., Vámos, A., Gáll, J.M., 2012. Influence of preharvest calcium appli-
cations,
fruit injury, and storage atmospheres on postharvest brown rot of apple.
Postharvest Biol. Technol. 67, 29–36.
Huang, R.H., Liu, J.H., Lu, Y.M., Xia, R.X., 2008. Effect of salicylic acid on the antioxi-
dant system in the pulp of ‘Cara cara’ navel orange (Citrus sinensis L. Osbeck) at
different storage temperatures. Postharvest Biol. Technol. 47, 168–175.
Ippolito, A., Schena, L., Pentimone, I., Nigro, F., 2005. Control of postharvest rots of
sweet cherries by pre- and postharvest applications of Aureobasidium pullulans
in combination with calcium chloride or sodium bicarbonate. Postharvest Biol.
Technol. 36, 245–252.
Kim, J., Luo, Y., Tao, Y., Saftner, R., Gross, K., 2005. Effect of initial oxygen concen-
tration and film oxygen transmission rate on the quality of fresh-cut romaine
lettuce. J. Sci. Food Agric. 85, 1622–1630.
Kou, L., Luo, Y., Yang, T., Xiao, Z., Turner, E.R., Lester, G.E., Wang, Q., Camp, M.J., 2013.
Postharvest biology, quality and shelf life of buckwheat microgreens. LWT –
Food Sci. Technol. 51, 73–78.
Kou, L., Turner, E.R., Luo, Y., 2012. Extending the shelf life of edible flowers with con-
trolled release of 1-methylcyclopropene and modified atmosphere packaging. J.
Food Sci. 77, S188–S193.
Kudla, J., Batistic, O., Hashimoto, K., 2010. Calcium signals: the lead currency of plant
information processing. Plant Cell 22, 541–563.
Kurepin, L.V., Joo, S.H., Kim, S.K., Pharis, R.P., Back, T.G., 2012. Interaction of
brassinosteroids with light quality and plant hormones in regulating shoot
growth of young sunflower and Arabidopsis seedlings. J. Plant Growth Regul. 31,
156–164.
Li, J.J., Wang, X.L., Qin, T., Zhang, Y., Liu, X.M., Sun, J.B., Zhou, Y., Zhu, L., Zhang, Z.D.,
Yuan, M., Mao, T.L., 2011. MDP25, a novel calcium regulatory protein, mediates
hypocotyl cell elongation by destabilizing cortical microtubules in Arabidopsis .
Plant Cell 23, 4411–4427.
Li, Z.H., Peng, J.Y., Wen, X., Guo, H.W., 2012. Gene network analysis and functional
studies of senescence-associated genes reveal novel regulators of Arabidopsis
leaf senescence. J. Int. Plant Biol. 54, 526–539.
Lim, P.O., Kim, H.J., Nam, H.G., 2007. Leaf senescence. Annu. Rev. Plant Biol. 58,
115–136.
Lin, K.H., Chiou, Y.K., Hwang, S.Y., Chen, L.F.O., Lo, H.F., 2008. Calcium chloride
enhances the antioxidative system of sweet potato (Ipomoea batatas) under
flooding stress. Ann. Appl. Biol. 152, 157–168.
Liu, H., Chen, F.S., Yang, H.S., Yao, Y.Z., Gong, X.Z., Xin, Y., Ding, C.H., 2009. Effect of cal-
cium treatment on nanostructure of chelate-soluble pectin and physicochemical
and textural properties of apricot fruits. Food Res. Int. 42, 1131–1140.
Luo, Y., McEvoy, J., Wachtel, M., Kim, J., Huang, Y., 2004. Package atmosphere affects
postharvest biology and quality of fresh-cut cilantro leaves. HortScience 39,
567–570.
Lurie, S., Fallik, E., Handros, A., Shapira, R., 1997. The possible involvement of perox-
idase in resistance to Botrytis cinerea in heat treated tomato fruit. Physiol. Mol.
Plant Pathol. 50, 141–149.
Marangoni, A.G., Palma, T., Stanley, D.W., 1996. Membrane effects in postharvest
physiology. Postharvest Biol. Technol. 7, 193–217.
Martin-Diana, A.B., Rico, D., Frias, J.M., Barat, J.M., Henehan, G.T.M., Barry-Ryan,
C., 2007. Calcium for extending the shelf life of fresh whole and minimally
processed fruits and vegetables: a review. Trends Food Sci. Technol. 18, 210–218.
Meilgaard, M., Civille, G., Carr, B., 1991. Sensory Evaluation Techniques, 2nd ed. CRC
Press Inc., Boca Raton, FL.
Mewis, I., Schreiner, M., Nguyen, C., Krumbein, A., Ulrichs, C., Lohse, M., Zrenner,
R., 2012. UV-B irradiation changes specifically the secondary metabolite profile
in broccoli sprouts: induced signaling overlaps with defense response to biotic
stressors. Plant Cell Physiol. 53, 1546–1560.
Moll, C., Jones, R.L., 1981. Calcium and gibberellin-induced elongation of lettuce
hypocotyl sections. Planta 152, 450–456.
Orozco-Cardenas, M.L., Narvaez-Vasquez, J., Ryan, C.A., 2001. Hydrogen perox-
ide acts as a second messenger for the induction of defense genes in tomato
plants in response to wounding, systemin, and methyl jasmonate. Plant Cell 13,
179–191.
Page, T., Griffiths, G., Buchanan-Wollaston, V., 2001. Molecular and biochemi-
cal characterization of postharvest senescence in broccoli. Plant Physiol. 125,
718–727.
Paliyath, G., Poovaiah, B.W., Munske, G.R., Magnuson, J.A., 1984. Membrane fluidity
in senescing apples – effects of temperature and calcium. Plant Cell Physiol. 25,
1083–1087.
Poovaiah, B.W., Leopold, A.C., 1973. Deferral of leaf senescence with calcium. Plant
Physiol. 52, 236–239.

78 L. Kou et al. / Postharvest Biology and Technology 87 (2014) 70–78
Poovaiah, B.W., Reddy, A.S.N., 1987. Calcium messenger system in plants. CRC Crit.
Rev. Plant Sci. 6, 47–103.
Prochazkova, D., Sairam, R.K., Srivastava, G.C., Singh, D.V., 2001. Oxidative stress and
antioxidant activity as the basis of senescence in maize leaves. Plant Sci. 161,
765–771.
Reddy, A.S.N., 2001. Calcium: silver bullet in signaling. Plant Sci. 160, 381–404.
Reddy, A.S.N., Koshiba, T., Theologis, A., Poovaiah, B.W., 1988. The effect of calcium
antagonists on auxin-induced elongation and on the expression of two auxin-
regulated genes in pea epicotyls. Plant Cell Physiol. 29, 1165–1170.
Saftner, R.A., Bai, J.H., Abbott, J.A., Lee, Y.S., 2003. Sanitary dips with calcium pro-
pionate, calcium chloride, or a calcium amino acid chelate maintain quality
and shelf stability of fresh-cut honeydew chunks. Postharvest Biol. Technol. 29,
257–269.
Singla, B., Chugh, A., Khurana, J.P., Khurana, P., 2006. An early auxin-responsive
Aux/IAA
gene from wheat (Triticum aestivum ) is induced by epibrassino-
lide and differentially regulated by light and calcium. J. Exp. Bot. 57,
4059–4070.Supapvanich, S., Arkajak, R., Yalai, K., 2012. Maintenance of postharvest quality and
bioactive compounds of fresh-cut sweet leaf bush (Sauropus androgynus L. Merr.)
through hot CaCl 2dips. Int. J. Food Sci. Technol. 47, 2662–2670.
Toivonen, P.M.A., Sweeney, M., 1998. Differences in chlorophyll loss at 13◦C for
two broccoli (Brassica oleracea L.) cultivars associated with antioxidant enzyme
activities. J. Agric. Food Chem. 46, 20–24.
White, P.J., Broadley, M.R., 2003. Calcium in plants. Ann. Bot. 92, 487–511.
Xiao, Z., Lester, G.E., Luo, Y., Wang, Q., 2012. Assessment of vitamin and carotenoid
concentrations of emerging food products: edible microgreens. J. Agric. Food
Chem. 60, 7644–7651.
Yang, T., Peng, H., Whitaker, B., Conway, W., 2012. Characterization of a
calcium/calmodulin-regulated SR/CAMTA gene family during tomato fruit
development and ripening. BMC Plant Biol. 12, 19.
Yang, T., Poovaiah, B.W., 2002. Hydrogen peroxide homeostasis: activation of plant
catalase
by calcium/calmodulin. Proc. Natl. Acad. Sci. U.S.A. 99, 4097–4102.
Yang, T.B., Poovaiah, B.W., 2003. Calcium/calmodulin-mediated signal network in
plants.
Trends Plant Sci. 8, 505–512.