Demodicosis is skin condition caused by mites from the Demodex genus, Demodicidae family, Arachnida class. These mites show host specificity (Holly… [307374]

[anonimizat], Arachnida class. These mites show host specificity (Holly N. Burr, Lee-[anonimizat] S. Roble, Neil S. Lipman, Chapter 32 – [anonimizat](s): Mark A. Suckow, Karla A. Stevens, Ronald P. Wilson, [anonimizat], [anonimizat], [anonimizat],2012,Pages 839-866,ISBN [anonimizat],https://doi.org/10.1016/B978-0-12-380920-9.00032-8.). Demodicosis in cats is extremely rare and it is caused by three species of Demodex mites ([anonimizat] a name but it has been reported in several research papers) (Beale K. 2012. FELINE DEMODICOSIS A [anonimizat]. Journal of Feline Medicine and Surgery; 14: 209–213). The location of adult mites can vary. Thus, D. [anonimizat] D. cati which is found within the hair follicle (Clifford E. Desch, Jr., T. Bonner S. 1999. Demodex gatoi: New Species of Hair Follicle Mite (Acari: Demodecidae) from the Domestic Cat (Carnivora: Felidae). J. Med. Entomol. 36(2): 167—170). [anonimizat], [anonimizat] (Rui K., Ayako H., Jun M., Sadao N., Seiichi N., Atsuhiko H., Hiroshi K. 2012. Feline demodicosis caused by an unnamed species. Research in Veterinary Science; 92(2): 257-258,ISSN 0034-5288,https://doi.org/10.1016/j.rvsc.2011.03.015. Moriello K.A., Newbury S., Steinberg H. 2013. Five observations of a third morphologically distinct feline Demodex mite. Vet Dermatol; 24: 460–e106). The most frequent locations identified in felines include the head (ears and periocular region), and also the dorsal area. [anonimizat], bacterial complications ([anonimizat] J, [anonimizat]. 2007. Deep and superficial skin scrapings from a [anonimizat]. Vet Clin Pathol.; 36(1):101-4. Taffin E.R., Casaert S., Claerebout E., Vandekerkhof T.J., Vandenabeele S. 2016. Morphological variability of Demodex cati in a [anonimizat]. J Am Vet Med Assoc.; 249(11):1308-1312.).

MATERIALS AND METHODS

History

The investigated patient was a common breed, 10 year old cat with no dermatological history. The cat was adopted by the owner at the age of 3 months and it was spayed after 2 consecutive births (2 years of age). [anonimizat]. [anonimizat]. The cat had become very sensitive to external stress factors.

[anonimizat]: alopecia, [anonimizat]. Dark, agglutinated cerumen was present in the external ear canal.

Diagnostic

Several deep skin scrapes were performed from the edge of the lesions. [anonimizat]-[anonimizat] 10x objective. (poate ar trebui mentionat si modelul microscopului?). The sample was clarified using mineral oil. Based on specific, morphological characteristics, the identified mites were classified as being part of the Demodex genus. Measurements were also performed in order to establish the specific sizes of the mites’ body segments (gnatosoma, podosoma and opistosoma). For a clear determination of the species, we collected biological material for PCR.

Following otoscopy, conducted after a pre-cleaning and removal of ear secretions, the cat was also diagnosed with bacterial otitis. An antibiogram was performed in order to proceed with the antibacterial treatment.

Due to the excessive weight loss of the animal, we also made a quick test for the identification of feline immune deficiency, based on the identification of serum, blood or plasma antibodies. The test returned with positive results.

The first follow-up was scheduled after 3 weeks from the initial check-up and the next follow-ups were scheduled within one month’s time. After every follow-up, we performed skin scrapes and we established the clinical evolution, following treatment.

PCR protocol. DNA was extracted from the skin scrapings, using a commercial kit, according to the manufacturer’s protocol for tissue samples (ISOLATE II Genomic DNA Kit, Bioline). DNA was amplified by PCR, as previously described by Frank et al. 2013. Amplification was performed using forward primer ACTGTGCTAAGGTAGCGAAGTCA and reverse primer TCAAAAGCCAACATCGAG to amplify 16S rRNA DNA, 2 µl Extracted DNA and MyTaq Red Mix (Bioline). PCR amplification parameters were 95°C for 90 s, followed by 35 cycles of 55°C for 30 s, 68°C for 120 s and 94°C for 30 s, with a final cycle consisting of 55°C for 30 s and 68°C for 5 min. The PCR product was visualized on an 1.5 % agarose gel stained with Midori Green™ (Nippon Genetics®; Europe Gmbh), cleaned with Isolate II PCR and Gel Kit (Bioline®) and sequenced using the forward and reverse PCR primers at Macrogen Europe® Company (Amsterdam, the Netherlands).

BLAST was used to compare the sequence with all entries available in GenBank.

Therapeutic protocol

The acaricidal treatment consisted of topical treatment using a fluralaner and moxidectin based pipette (Bravecto plus®, MSD). The used dose was 250 mg/animal weighing 2.8 – 6.25 kg, administered monthly (4 total administrations). In order to improve the immune function, we recommended the use of RX immuno support® (Rx vitamins), capsules per os (1×1/day, for 10 days, repeated after 10 days).

The bacterial otitis was treated by daily cleansing of the external ear canal using Epiotic®(Virbac) solution containing salicylic acid, followed by instillation of 3-5 drops/ear of Aurizon® (Virbac) – marbofloxacin, clotrimazole, dexamethasone acetate, 2 times/day for 15 days.

RESULTS AND DISCUSSIONS

PCR amplification of DNA extracted from Demodex mites produced a single band of ~330 bp.

The product matched 100% with …………. sequences deposited in GenBank ……………… throughout the entire compared region.

The primers used are highly conserved among Demodex species, including D. gatoi, D. caprae, D. brevis, D. folliculorum, D. canis, D. injai and an unnamed species affecting cats (Bernstein 2014, Frank 2013).

The body sizes of 7 Demodex mites (3 males and 4 females) are presented in Table 1. The arithmetic average of the mites’ total length was (Fig.1):

198.33 µm, with 15 µm (gnatosoma), 55 µm (podosoma) and 127.66 µm (opistosoma), for males;

201.5 µm, with 18 µm (gnatosoma), 49 µm (podosoma) and 134.5 µm (opistosoma), in females.

According to studies, Demodex cati shows similar sizes to those identified in our study. Lowenstein et al. noticed values of 181.7±17.9 µm of the total length, in males, with the gnatosoma measuring 14.7±1.2 µm, the podosoma 52.2±2.6 µm and the opistosoma 114.2±17.0 µm. Females had a total length of 219.0±27.4 µm, with the gnatosoma measuring 16.2±1.9 µm, the podosoma 58.7±2.6 µm and the opistosoma 143.9±25.4 µm (Lowenstein, C., Beck, W., Bessmann, K., Mueller, R.S.2005. Feline demodicosis caused by concurrent infestation with Demodex cati and an unnamed species of mite. The Veterinary record; 157(10): 290-292.). Values of 181.7±17.9 µm (males) and 219±27.4 µm (females), representing the total length were reported by Taffin et al.( Taffin E.R., Casaert S., Claerebout E., Vandekerkhof T.J., Vandenabeele S. 2016. Morphological variability of Demodex cati in a feline immunodeficiency virus-positive cat. J Am Vet Med Assoc.;249(11):1308-1312.).

In the case of Demodex gatoi, studies indicate values of 90.6±4.8µm (gnatosoma 14.5± 0.4 µm , podosoma 39.5±1.3 µm, opistosoma 36.6±4.1 µm)( Clifford E. Desch, Jr., T. Bonner S. 1999. Demodex gatoi: New Species of Hair Follicle Mite (Acari: Demodecidae) from the Domestic Cat (Carnivora: Felidae). J. Med. Entomol. 36(2): 167—170) and 90.6±4.8 µm (Taffin E.R., Casaert S., Claerebout E., Vandekerkhof T.J., Vandenabeele S. 2016. Morphological variability of Demodex cati in a feline immunodeficiency virus-positive cat. J Am Vet Med Assoc.;249(11):1308-1312.), representing the total length of males. The total length values noticed in females were 108.3±4.4 µm (gnatosoma 15.5±0.7 µm, podosoma 42.3±1.6 µm, opistosoma 50.3±4.0 µm)( Clifford E. Desch, Jr., T. Bonner S. 1999. Demodex gatoi: New Species of Hair Follicle Mite (Acari: Demodecidae) from the Domestic Cat (Carnivora: Felidae). J. Med. Entomol. 36(2): 167—170) and 108.3±4.4 µm (Taffin E.R., Casaert S., Claerebout E., Vandekerkhof T.J., Vandenabeele S. 2016. Morphological variability of Demodex cati in a feline immunodeficiency virus-positive cat. J Am Vet Med Assoc.;249(11):1308-1312.).

Smaller sizes, respectively 170.8±1.4 µm (gnatosoma 24.3±0.8 µm, podosoma 58.2±0.9 µm, opistosoma 88.4±0.5 µm) (Lowenstein, C., Beck, W., Bessmann, K., Mueller, R.S.2005. Feline demodicosis caused by concurrent infestation with Demodex cati and an unnamed species of mite. The Veterinary record; 157(10): 290-292) and 140 – 175 µm (Taffin E.R., Casaert S., Claerebout E., Vandekerkhof T.J., Vandenabeele S. 2016. Morphological variability of Demodex cati in a feline immunodeficiency virus-positive cat. J Am Vet Med Assoc.;249(11):1308-1312.) representing the total length were noticed in Demodex spn males.

Tabel 1. Demodex mites body sizes

Fig.1. Male Demodex – body segments sizes

The applied therapy based on the use of fluralaner and moxidectin proved successful and 3 weeks post-treatment the skin scrapes were negative.

Fig.2. A, B –alopecia, erythema, small ulcerations and crusts in the external ear canal (before treatment); C – black secretions are present in the external ear canal; D, E hair regrowth in the ear area and decrease in size of ulcerative lesions, absence of crusts (following treatment, 3 weeks)

References

Beale K. 2012. FELINE DEMODICOSIS A consideration in the itchy or overgrooming cat. Journal of Feline Medicine and Surgery; 14: 209–213

Clifford E. Desch, Jr., T. Bonner S. 1999. Demodex gatoi: New Species of Hair Follicle Mite (Acari: Demodecidae) from the Domestic Cat (Carnivora: Felidae). J. Med. Entomol. 36(2): 167—170

Clifford E. Desch, Jr., T. Bonner S. 1999. Demodex gatoi: New Species of Hair Follicle Mite (Acari: Demodecidae) from the Domestic Cat (Carnivora: Felidae). J. Med. Entomol. 36(2): 167—170) și 90.6±4.8 µm (Taffin E.R., Casaert S., Claerebout E., Vandekerkhof T.J., Vandenabeele S. 2016. Morphological variability of Demodex cati in a feline immunodeficiency virus-positive cat. J Am Vet Med Assoc.;249(11):1308-1312.

Holly N. Burr, Lee-Ronn Paluch, Gordon S. Roble, Neil S. Lipman, Chapter 32 – Parasitic Diseases, Editor(s): Mark A. Suckow, Karla A. Stevens, Ronald P. Wilson, In American College of Laboratory Animal Medicine, The Laboratory Rabbit, Guinea Pig, Hamster, and Other Rodents,Academic Press,2012,Pages 839-866,ISBN 9780123809209,https://doi.org/10.1016/B978-0-12-380920-9.00032-8.

Lowenstein, C., Beck, W., Bessmann, K., Mueller, R.S.2005. Feline demodicosis caused by concurrent infestation with Demodex cati and an unnamed species of mite. The Veterinary record; 157(10): 290-292.

Neel JA, Tarigo J, Tater KC, Grindem CB. 2007. Deep and superficial skin scrapings from a feline immunodeficiency virus-positive cat. Vet Clin Pathol.; 36(1):101-4. Taffin E.R., Casaert S., Claerebout E., Vandekerkhof T.J., Vandenabeele S. 2016. Morphological variability of Demodex cati in a feline immunodeficiency virus-positive cat. J Am Vet Med Assoc.; 249(11):1308-1312.

Rui K., Ayako H., Jun M., Sadao N., Seiichi N., Atsuhiko H., Hiroshi K. 2012. Feline demodicosis caused by an unnamed species. Research in Veterinary Science; 92(2): 257-258,ISSN 0034-5288,https://doi.org/10.1016/j.rvsc.2011.03.015. Moriello K.A., Newbury S., Steinberg H. 2013. Five observations of a third morphologically distinct feline Demodex mite. Vet Dermatol; 24: 460–e106

Taffin E.R., Casaert S., Claerebout E., Vandekerkhof T.J., Vandenabeele S. 2016. Morphological variability of Demodex cati in a feline immunodeficiency virus-positive cat. J Am Vet Med Assoc.;249(11):1308-1312.