Molecular Analysis Of Community Acquired Human Staphylococcus Aureus Strains Isolated From Skindoc

=== Molecular analysis of community-acquired human staphylococcus aureus strains isolated from skin ===

Molecular Analysis of Community-Acquired human Staphylococcus aureus strains isolated from Skin and Soft-Tissue Infections (SSTIs) in Romania

Elena-Carmina Drăgulescu

Abstract (150-200 words)

Staphylococcus (S.) aureus is a ubiquitary Gram-positive cocci implicated in community-acquired (CA) and hospital-acquired (HA) skin and soft tissues infections (SSTIs) all over the world. Panton-Valentine Leukocidin (PVL), a cytotoxin – one of the β-pore forming toxin are detected in some clonal strains by molecular methods for lukS/F genes. PVL creates pores in the membranes of infected cells and is produced from the genetic material of a bacteriophages (prophages) that infects S. aureus, making it more virulent. The aim of this study was to investigate the S. aureus isolate from SSTIs in two period (A – January to November 2014 and B – May to August 2015). Materials and methods. A total number of seventy-one S. aureus strains (A – 42; B – 29) were collected in Medical Analysis Laboratory of National Institute of Research ''Cantacuzino'' and one University Hospital Emergency Ambulatory Care from Bucharest. This strains were isolated from SSTIs: acne, cellulitis, folliculitis, furunculosis, paronchyia, pustule, abscess, leg wound. Results and discussions. The strains from A with spa types t008, t019, t044, t284, t355, t435, t437, t1211, t1889, t5841, t14513 and one strain from B with spa type t021 were positive for lukS/F genes. From A two strains with spa types t223, t1889 and four strains from B with spa types t012, t021 (2), t582 were positive for tst gene. This study was enriched the international databases with three new spa-types. Conclusions. Molecular methods represents a good instruments for typing S. aureus PVL and TSST producing strains isolated from different SSTIs of out and inpatients.

Keywords: Staphylococcus aureus, methicillin-resistant, Panton-Valentine Leukocidin, tst gene

1. Introduction

In the past, community-acquired methicillin-resistant S. aureus (CA-MRSA) infections tended to occur in patients with frequent health care contact or in specific groups of patients, such as intravenous drug users (4D.P. LEVINE et al. []). The epidemiology of community-onset infections caused by MRSA changed dramatically during the past decade (1H.F. CHAMBERS []), (5S. DERESINSKI []). Young, healthy individuals who lack classic risk factors for MRSA infection are often affected (6N.F. CRUM et al. []), (7G.J. MORAN et al. []), (8K. PURCELL et J. FERGIE []), (9B.C. HEROLD et al. []). CA-MRSA infections, which were first described in small series of adult and pediatric patients presenting with skin and soft tissue infections (SSTIs), pneumonia, or bacteremia (B.C. HEROLD et al. []); (10E.J. GORAK et al. []); (11CENTERS FOR DISEASE CONTROL AND PREVENTION []), have become a significant public health threat in the United States and all over the world (2H. GRUNDMANN et al. []); (12R.C. MOELLERING JR. []). In the United States, a single clone of CA-MRSA (USA300 ST-8) has become the most prevalent cause of staphylococcal SSTIs acquired in the community (13M.D. KING et al. []); (14F.C. TENOVER et al. []) and has moved into the inpatient setting, causing not only SSTIs, but also invasive diseases (15S.L. DAVIS et al. []); (16B.E. GONZALEZ et al. []); (17R.M. KLEVENS et al. []).

In the United States, strains of CA-MRSA carry the staphylococcal cassette chromosome (SCC) mec type IV (usually clone USA300), and most carry the gene for PVL (6N.F. CRUM et al. []), (7G.J. MORAN et al. []); (13M.D. KING et al. []). From an epidemiologic standpoint, the definition of CA-MRSA is problematic. Most studies have used a timebased definition (e.g., infections recognized within 24 – 72 h after hospital admission) (18C.D. SALGADO et al. []). However, S. aureus can persist as a colonizer for months or years (19A. SCANVIC et al. []); (20M.D. SANFORD et al. []), leading to misclassification of the source. Indeed, some “community-onset” infections may in fact be caused by hospital-acquired strains and vice versa (18C.D. SALGADO et al. []); (19A. SCANVIC et al. []); (21R.M. KLEVENS et al. []). CA-MRSA is invading US hospitals (15S.L. DAVIS et al. []); (16B.E. GONZALEZ et al. []); (21R.M. KLEVENS et al. []). Thus, the distinction between CA-MRSA and hospital-acquired MRSA (HA-MRSA) (21R.M. KLEVENS et al. []); (22J.T. WEBER []); (23A.L. CAMPBELL et al. []) is blurring. Nevertheless, the presence of SCCmec type IV and the presence of PVL have been useful molecular markers of CA-MRSA strains (24H.A. CARLETON et al. []). Direct contact with infected patients (7G.J. MORAN et al. []), colonized subjects (38M.W. ELLIS et al. []); (52H.A. COOK et al. []), or a contaminated environment (35E.M. BEGIER et al. []); (49H.C. BAGGETT et al. []) is implicated in the transmission of CA-MRSA infection.

The epidemic character of community-associated MRSA, especially the geographically widespread clone USA300, is poorly understood. USA300 isolates carry a type IV staphylococcal chromosomal cassette mec (SCCmec) element conferring β-lactam antibiotic class resistance and a putative pathogenicity island, arginine catabolic mobile element (ACME). Physical linkage between SCCmec and ACME suggests that selection for antibiotic resistance and for pathogenicity may be interconnected. We constructed isogenic mutants containing deletions of SCCmec and ACME in a USA300 clinical isolate to determine the role played by these elements in a rabbit model of bacteremia. We found that deletion of type IV SCCmec did not affect competitive fitness, whereas deletion of ACME significantly attenuated the pathogenicity or fitness of USA300. These data are consistent with a model in which ACME enhances growth and survival of USA300, allowing for genetic “hitchhiking” of SCCmec. SCCmec in turn protects against exposure to β-lactams (B. AN DIEP, G.G. STONE, LI BASUINO, CH.J. GRABER, A. MILLER, SHELLEY-ANN DES ETAGES, A. JONES, A.M. PALAZZOLO-BALLANCE, F. PERDREAU-REMINGTON, G.F. SENSABAUGH, F.R. DELEO, AND H.F. CHAMBERS []).

Human skin represent a physical barrier and the first line of immunological defense against external injurious stimuli and hurtful insult. External layers of the skin are particularly hostile to pathogenic bacteria. If an organism breaches these physical barriers, the skin has the capacity to recognize molecular determinants of pathogenic bacteria to facilitate host cell signaling and immune cell chemotaxis, thereby bolstering the immune response and providing an additional level of defense (L.S. MILLER and J.S. CHO []). S. aureus is a worldwide important opportunistic human and animal pathogen that can cause a wide spectrum of diseases attributable to the range of virulence factors it is able to express (the production of specialized binding proteins, immune evasion molecules, and immune cell targeting toxins) (T.J. FOSTER []). Factors that interfere with the host innate immune response are of critical importance to the success of this pathogen (C.E. TURNER and S. SRISKANDAN []). It is capable of rapid adaptation to host insult in order to promote survival in different conditions. Through gene acquisition and alterations in regulatory networks, S. aureus is able to counter the physical and immunological barriers of the skin. Its environmental adaptability coupled with an increase in antibiotic resistance among infectious isolates make S. aureus a major public health concern.

Infections caused by CA-MRSA are emerging as a major public health problem and has become epidemic. SSTIs are the most frequent forms of the disease. CA-MRSA has been associated previously with SSTIs and with carriage of staphylococcal cassette chromosome mec (SCCmec) type IV and the PVL virulence factor. SSTIs are common and range in severity from minor, self-limiting, superficial infections to life-threatening diseases requiring all the resources of modern medicine. The classification of SSTIs can be based on the anatomical site, clinical severity or microbial cause, but some classifications divide SSTIs into complicated and uncomplicated infections. Community-acquired SSTIs (CA-SSTIs) are most commonly caused by staphylococci or streptococci, but almost any organism is capable of causing inflammation within soft tissue. Recent epidemiological trends have shown an increase not only in healthcare-associated MRSA, but also in MRSA acquired in the community. Many of the latter strains produce exotoxins and are epidemiologically distinct from healthcare-acquired strains. Factors that may affect the microbial cause include underlying disease such as diabetes or immune dysfunction; hospital attendance, injecting drug use, travel, animal contact and environmental contamination (M.S. DRYDEN []).

Complicated skin and soft tissue infections (cSSTIs) are a diverse group of infections, with a range of presentations and microbiological causes. Hospitalization is common for patients with a cSSTI, which is treated by drainage of the affected area and with antibiotics. Host factors such as co-morbidities and microbial factors, in particular drug resistance, complicate the management of these infections. MRSA is an important cSSTI pathogen in Europe, and its involvement can be associated with poor patient outcomes. Therapeutic strategies of SSTIs management should bear some different fluctuating data in mind: epidemiological trends (community or hospital acquired infections), pathogen or pathogens involved, virulence, gravity of pathology (possible co-morbidities, knowledge of local epidemiology and antimicrobial susceptibility patterns of community and hospital strains). Therapy often should be initiated without delay, and on an empiric base, once microbiological analysis have been accomplished, waiting for culture and antimicrobial susceptibility testing for documentation of the presence of MRSA. Surgical incision and drainage serve as essential therapeutic procedures in the treatment of many problematic SSTIs such as abscesses and fasciitis. Gram-positive bacteria and particularly S. aureus, are the major cause of such infections. First recognized in 1960, MRSA was considered to be a medical strangeness and in present the cause of such infections. MRSA became the most common nosocomial bacterial pathogen isolated in many parts of the world [1–3]. Consequently, antistaphylococcal beta-lactams represent a first option in empirical antimicrobial chemotherapy. Taking into account the high incidence of penicillin resistant and MRSA strains in Romanian hospitals, treatment of hospital acquired SSTIs should be based on glycopeptides combined with third generation cephalosporins, piperacillin-tazobactam, carbapenems or fluoroquinolones. Recently, new drugs (as linezolid, daptomycin, tigecycline) demonstrated good efficacy in the treatment of serious infections caused by multi-drug resistant microorganisms. Most recent guidelines for the diagnosis and treatment of SSTIs were published in 2005 by Infectious Diseases Society of America (IDSA). General approach and methodology in writing test were based on analysis of data from available scientific literature and comparing them with actual Italian epidemiological trends and drug prescribing policy. Considering these guidelines, we updated the newest antimicrobial drugs suggested for the treatment of SSTIs, such as daptomycin and tigecycline. European guidelines recommend vancomycin, teicoplanin, linezolid, daptomycin, tigecycline or ceftaroline for treatment of MRSA cSSTIs (M. BASSETTI et al. []). The Infectious Diseases Society of America guidelines recommend vancomycin or linezolid for empirical treatment if MRSA is suspected [19]. Ceftobiprole may become an important new antibiotic for complicated skin and skin-structure infections before microbiological results allow streamlining of antimicrobial therapy. MRSA coverage with ceftobiprole may improve outcome by enabling early bactericidal therapy in patients admitted to emergency departments because of complicated skin and skin-structure infections not yet identified as being due to MRSA. In addition, mixed infections involving MRSA could be treated with ceftobiprole, replacing vancomycin-based combination therapy (A.F. WIDMER []). The SIS guidelines cover the diagnosis and treatment of the full spectrum of cSSTIs, including necrotizing infections that destroy surrounding tissue, nosocomial infections that occur in chronic disease settings, infections caused by bites or exposure to contaminated water, and community-acquired infections caused by MRSA ([]). Purulent lesions should be drained whenever possible. In areas where CA-MRSA isolates are prevalent, uncomplicated SSTI in healthy individuals may be treated empirically with clindamycin, trimethoprim-sulfamethoxazole, or long-acting tetracyclines, although specific data supporting the efficacy of these treatments are lacking. In healthy patients with small purulent lesions, drainage alone may be sufficient. In patients with cSSTI requiring hospitalization or intravenous therapy, vancomycin is the drug of choice because of the low cost, efficacy, and safety. Linezolid, daptomycin, and tigecycline are also effective, although published studies on the last 2 agents for the treatment of SSTI due to MRSA are more limited. Dalbavancin, telavancin, and ceftobiprole are investigational agents that may expand our therapeutic options for the treatment of SSTI caused by MRSA (M.E. STRYJEWSKI AND H.F. CHAMBERS []).

PVL is one of four pore forming bi-component toxins that may be expressed by S. aureus strains. The other three are gamma-haemolysin (HlgABC), LukFS (also known as LukAB or LukGH) and LukDE. The two co-transcribed components of PVL, LukS-PV and LukF-PV, when combined can lyse human cells expressing C5a receptors, including neutrophils (A.N. SPAAN et al. []). In North America and spreading globally, PVL has been mainly associated with strains of CA-MRSA (A. TRISTAN et al. []); (F. VANDENESCH et al. []), but UK based studies suggest a more common association with community-acquired methicillin-sensitive S. aureus (CA-MSSA) strains (L.J. SHALLCROSS et al. []). It is important for clinicians to be familiar with the incidence of CA-MRSA in their communities, as prevalence can vary from region to region. The rate of methicillin resistance in Romania in 2007 was 39% in Bucharest, and very high in Timișoara – 53% and in Iași – 56% (L. COCHIOR et al. []); (E. MIFTODE et al. []); (G.A. POPESCU et al. []).

PVL-producing CA-MRSA cause suppurative SSTIs and severe necrotising pneumonia (G. LINA et al. []); (L. KREIENBUEHL et al. []). Thereby, PVL is thought to be an important virulence factor and in these infections as well as a stable marker for CA-MRSA (F. VANDENESCH et al. []) or CA-MSSA (A. KALTSAS et al. []).

The effects of antimicrobial agents (especially antibiotics) to S. aureus PVL-producing strains were described (O. DUMITRESCU et al. []); (C.E. TURNER et S. SRISKANDAN []). Non-methicillin-resistant S. aureus skin and soft tissue abscesses and many CA-MRSA soft tissue infections can be treated with incision and drainage, an adequate therapy, without the use of antibiotics (M.C. LEE et al. []).

In this work we aimed to investigate and compare S. aureus strains implicated in SSTIs isolated from two periods of time (A and B).

2. Materials and Methods

Patients and Bacterial isolates

A total of seventy-one patients (A – 42; B – 29) presented to the Cantacuzino Institute Laboratory for Medical Analyses (A) and to the Emergency Room of Elias University Emergency Hospital in Bucharest (B) with acute and chronic SSTIs were enrolled in this study. All seventy-one S. aureus isolates were collected from these patients during the period of January to November 2014 (A) and May to August 2015 (B). All isolates enrolled in this study were identified by a combination of phenotypic and genotypic tests. Community-acquired S. aureus (CA-SA) is defined as S. aureus isolated from an outpatient or within 2 days of a patient’s hospitalization.

Antimicrobial susceptibility testing

Antimicrobial susceptibility profiles of S. aureus isolates were determined by the Kirby-Bauer disk diffusion method, according to EUCAST 2014 and 2015 guidelines [15]. Antibiotics tested included benzylpenicillin (P, 1 units), cefoxitin (FOX, 30 μg), erythromycin (E, 15 μg), clindamycin (DA, 2 μg), gentamicin (CN, 10 μg), tobramycin (TOB, 10 μg), ciprofloxacin (CIP, 5 μg), tetracycline (TE, 30 μg), rifampicin (RD, 5 μg), chloramphenicol (C, 30 μg), sulfamethoxazole-trimethoprim (SXT, 25 μg), quinupristin-dalfopristin (QD, 15 μg), linezolid (LZD, 10 μg), fusidic acid (FD, 10 μg) and mupirocin (MUP, 200 μg). The minimum inhibitory concentration (MIC) of vancomycin was detected by microdilutions in Mueller-Hinton broth. Inducible clindamycin resistance was determined by the D-test. S. aureus ATCC 29213 were used as quality controls for the disk diffusion test and MIC detection, respectively.

DNA extraction

Total genomic DNA was obtained by thermal and/or enzymatic lysis method (lysostaphin 1U/µL, proteinase K 2 mg/mL).

Detection of toxin genes by PCR

A variety of clinically significant toxin genes were detected by PCR, including nuc (encoding thermonuclease); lukS/F-PV (encoding PVL) and mecA (encoding resistance to methicillin) by a triplex PCR protocol optimized in our laboratory [EC Dragulescu, M Oprea, M Straut, Irina Codita. Detectarea rapidă a tulpinilor de Staphylococcus aureus comunitar meticilino-rezistent folosind tehnica PCR multiplex, A XI-a Reuniune Anuală de Microbiologie, 24-26 mai 2007, Mamaia, Romania – poster]; tst (encoding toxic shock syndrome toxin 1); eta and etb (encoding exfoliative toxin A and B).

Triplex PCR protocol for nuc, lukS/F and mecA genes detection consists in: 2 µl of target DNA, 5 µl of Taq DNA polymerase 5X buffer (Promega), 0,2 mM of dNTPs mix, 5 pmol of nuc, mecA each primers and 10 pmol for lukS/F each primer (Invitrogen) and 1,5U of Taq DNA polymerase (stock solution 5U/ µl, Promega). The final volume was adjusted to 25 µl with distilled water (DN-ase, RN-ase free).

Simplex PCR protocol for each virulence factors: toxic shock syndrome toxin 1 (tst), the exfoliative toxins (eta, etb) detection consists in: 3 µl of target DNA, 5 µl of Taq DNA polymerase 5X buffer (Promega), 0,2 mM of dNTPs mix, 10 pmol of each primer (Invitrogen) and 1,25U of Taq DNA polymerase (stock solution 5U/ µl, Promega). The final volume was adjusted to 25 µl with distilled water (DN-ase, RN-ase free).

For simplex and triplex PCR (nuc, lukS/F, mecA) the primers used are listed in Table 1 and the amplification program is listed in Table 2.

Detection of antimicrobial resistance genes by PCR

Antimicrobial resistance genes were detected by PCR, including blaZ (encoding benzylpenicillin resistance) [F Martineau, FJ Picard, N Lansac, C Menard, PH Roy, M Ouellette, and MG Bergeron. Correlation between the resistance genotype determined by multiplex PCR assays and the antibiotic susceptibility patterns of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob. Agents Chemother., 44, 231, 238 (2000)]; ermA and ermC (encoding erythromycin and clindamycin resistance); aacA-aphD (encoding aminoglycoside resistance); tetK and tetM (encoding tetracycline resistance) [B Strommenger, Ch Kettlitz, Werner G, Witte W. Multiplex PCR Assay for Simultaneous Detection of Nine Clinically Relevant Antibiotic Resistance Genes in Staphylococcus aureus. J. Clin. Microbiol., 41, 4089, 4094 (2003)].

Simplex PCR protocol for each antimicrobial resistance genes: blaZ, ermA, ermC, aacA-aphD, tetK, tetM genes detection consists in: 3 µl of target DNA, 5 µl of Taq DNA polymerase 5X buffer (Promega), 0,2 mM of dNTPs mix, 10 pmol of each primer (Invitrogen) and 1,25U of Taq DNA polymerase (stock solution 5U/ µl, Promega). The final volume was adjusted to 25 µl with distilled water (DN-ase, RN-ase free).

For simplex PCR the primers used are listed in Table 1 and the amplification program is listed in Table 2.

Table 1.

PCR primers used in triplex and simplex PCR

Table 2.

Cycling conditions for triplex and simplex PCR

The following reference strains were used as controls: 33/ 2009 strain (Nosocomial Infections Laboratory collection) for nuc, lukS/F, mecA genes, IC13456 strain (for eta gene), IC13455 strain (for etb gene), IC13454 strain (for tst gene), 5681/ 2010 strain (Nosocomial Infections Laboratory collection) for blaZ, ermC, aacA-aphD, tetK genes, 39/ 2008 strain (Nosocomial Infections Laboratory collection) for tetM gene.

The PCR products were resolved by agarose (1,5% and 2%) gel electrophoresis at 80V for 48 minutes, stained with ethidium bromide and visualized in UV transilluminator.

SCCmec typing was performed by multiplex PCR after scheme proposed by Milheirico et al., 2007 [C Milheirico, DC Oliveira, and H de Lencastre. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob. Agents Chemother., 51, 3374, 3377 (2007)]. Sequences of primers used in SCCmec typing scheme are presented in Table 3. The following reference strains were used as controls: COL (SCCmec type I), BK2464 (SCCmec type II), ANS46 (SCCmec type III), MW2 (SCCmec type IVa), WIS (SCCmec type V), HDE288 (SCCmec type VI).

Table 3.

The sequences of primers used in SCCmec typing scheme

Spa typing

Detection of polymorphism in the X region of the staphylococcal protein A (spa) gene was carried out as described by Harmsen et al., 2003 [D Harmsen, H Claus, W Witte, J Rothganger, H Claus, D Turnwald, & U Vogel. Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting using a novel software for spa-repeat determination and database management. J. Clin. Microbiol. 41, 5442, 5448 (2003)] using the forward primer spa-1113f: 5’TAAAGACGATCCTTCGGTGAGC3’ and the reverse primer spa-1514r: 5’CAGCAGTAGTGCCGTTTGCTT3’. PCR products were purified using Wizard® SV Gel and PCR Clean-Up System (Promega Corporation). PCR products of the spa gene were sequenced using the same PCR primers and BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) as recommended by manufacturer on an Applied BioSystems ABI PRISM 3130 Genetic Analyzer. Finding of the spa repeat code and classification of strain into the spa types were done using Ridom StaphType software (Ridom GmbH, Wurzburg, Germany).

All the PCR reactions were performed in an Applied Biosystems and Corbett Research Thermocycler.

3. Results and Discussions

Clinical data

The median age of patients was A: 40; B: 44.2 years (range: A: 4 – 76 years ago; B: 4 month – 88 years ago), while the sex distribution (male/female) was A: 26/16 (61.90%/38.10%); B: 10/19 (34.48%/65.52%). All the patients were outpatients.

Antimicrobial susceptibility testing

From A period seventeen isolates were MSSA; twenty-five isolates were confirmed as MRSA and from B period twenty-four isolates were MSSA; five isolates were confirmed as MRSA. The results of antimicrobial susceptibility testing ((pattern of resistance) are presented in table 4, 5.

Table 4. Antimicrobial susceptibility testing (A period)

Table 5. Antimicrobial susceptibility testing (B period)

Strains isolated in the A period were found resistant to: P 40 (95,23%), FOX (MRSA) 25 (59,52%), E 21 (50%), DA 18 (42,85%), from which 17 (40,77%) harboured MLSBi; TE 17 (40,77%), QD 17 (40,77%), CIP 2 (4,76%), FD 3 (7,14%); those isolated in the B period: P 27 (93,10%), FOX (MRSA) 5 (17,24%), E 13 (44,82%) and E intermediate 1 (6,9%), DA 13 (44,82%) and DA intermediate 3 (10,34%), from which 13 (44,82%) harboured MLSBi; TOB 5 (17,24%), CN 4 (13,79%), TE 13 (44,82%) and TE intermediate 2 (6,89%), CIP 2 (6,89%), RD 1 (3,44%) and RD intermediate 9 (31,03%), QD 13 (44,82%) and QD intermediate 3 (10,34%), FD 5 (17,24%).

All the strains resistant to cefoxitin were mecA positive and SCCmec type III, IV and IVE. All the strains resistant to penicillin were positive for blaZ gene. All the strains resistant to tetracycline (29) were positive for tetK gene and one strain was positive for tetM gene. The strains resistant to erythromycin and clindamycin with MLSBi phenotype resistance were positive for ermC gene. Two strains from B period with phenotypic resistance to TOB and CN were negative for aacA-aphD1 genes and two were positive.

Virulence factors

All the strains were positive for nuc gene. The lukS/F-PV genes were found in twenty isolates from A period and one isolate from B period; two strains from A period and four strains from B period were positive for tst gene. The distribution of the strains in spa types are presented in table 5, 6.

Table 5. The distribution of the strains in spa types (A)

Table 5. The distribution of the strains in spa types (B)

The spa types t14512, t14513 PVL positive and t15296 were discover for the first time in this study. The chromatograms of new spa-types and all-types from this study were uploaded on international databases – http://www.spaserver.ridom.de/ [Harmsen D, Claus H, Witte W, Rothgänger J, Claus H, Turnwald D, Vogel U (2003). Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting using a novel software for spa-repeat determination and database management. J. Clin. Microbiol. 41; Mellmann A, Friedrich AW, Rosenkötter N, Rothgänger J, Karch H, Reintjes R, Harmsen D. (2006). Automated DNA sequence-based early warning system for the detection of methicillin-resistant Staphylococcus aureus outbreaks. PLoS Med. 3(3)].

4. Conclusions

The detection of S. aureus PVL positive strains with molecular typing methods help us to take the good measures to prevent the disemination of this clones implicated in necrotizing pneumonia and complicated suppurative skin infectionsboth in community and hospitals settings. The surveillance of S. aureus strains involved in skin infections is very important and should be done regularly for proper treatment and limiting dissemination of MRSA clones producing Panton-Valentine leukocidin and toxic shock syndrome toxin. Supravegherea tulpinilor de S. aureus implicate in infectii tegumentare este foarte importanta si trebuie sa se faca in mod regulat pentru un tratament corespunzator si limitarea diseminarii clonelor de MRSA producatoare de leucocidina Panton-Valentine si a toxinei sindromului de soc toxic.

Acknowledgements

References

L.S. MILLER & J.S. CHO. Immunity against Staphylococcus aureus cutaneous infections. Nat. Rev. Immunol., 11, 505-518 (2011).

T.J. FOSTER Immune evasion by staphylococci. Nat. Rev. Microbiol., 3(12): 948-58 (2005).

B.AN DIEP, G.G. STONE, LI BASUINO, CH.J. GRABER, A. MILLER, SHELLEY-ANN DES ETAGES, A. JONES, A.M. PALAZZOLO-BALLANCE, F. PERDREAU-REMINGTON, G.F. SENSABAUGH, F.R. DELEO, AND H.F. CHAMBERS. The Arginine Catabolic Mobile Element and Staphylococcal Chromosomal Cassette mec Linkage: Convergence of Virulence and Resistance in the USA300 Clone of Methicillin-Resistant Staphylococcus aureus. The Journal of Infectious Diseases, 197, 1523–30 (2008).

C.E. TURNER, S. SRISKANDAN. Pantone-Valentine leucocidin expression by Staphylococcus aureus exposed to common antibiotics. Journal of Infection, 71, 338-346 (2015).

A.N. SPAAN, T. HENRY, W.J. VAN ROOIJEN, M. PERRET, C. BADIOU, P.C. AERTS,  J. KEMMINK, C.J. de HAAS, K.P. van KESSEL, F. VANDENESCH, G. LINA, J.A. van STRIJP. The staphylococcal toxin PVL targets human C5a receptors. Cell Host Microbe, 13, 584-594 (2013).

G. LINA, Y. PIEMONT, F. GODAIL-GAMOT, M. BES, M.O. PETER, V. GAUDUCHON, F. VANDENESCH, J. ETIENNE. Involvement of Pantone-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin. Infect. Dis., 29, 1128-1132 (1999).

L. KREIENBUEHL, E. CHARBONNEY, AND PH. EGGIMANN. Community-acquired necrotizing pneumonia due to methicillin-sensitive Staphylococcus aureus secreting Panton-Valentine leukocidin: a review of case reports. Annals of Intensive Care., 1, 52 (2011).

A. TRISTAN, M. BES, H. MEUGNIER, G. LINA, B. BOZDOGAN, P. COURVALIN, M.-E. REVERDY, M.C. ENRIGHT, F. VANDENESCH, J. ETIENNE. Global distribution of Pantone-Valentine leukocidine positive methicillin-resistant Staphylococcus aureus, 2006. Emerg. Infect. Dis., 13, 594-600 (2007).

F. VANDENESCH, T. NAIMI, M.C. ENRIGHT, G. LINA, G.R. NIMMO, H. HEFFERNAN, N. LIASSINE, M. BES, T. GREENLAND, M.E. REVERDY, J. ETIENNE. Community-acquired methicillin-resistant Staphylococcus aureus carrying Pantone-Valentine leukocidin genes: worldwide emergence. Emerg. Infect. Dis., 9, 978-984 (2003).

L.J. SHALLCROSS, K. WILLIAMS, S. HOPKINS, R.W. ALDRIDGE, A.M. JOHNSON, A.C. HAYWARD. Pantone-Valentine leukocidin associated staphylococcal disease: a cross-sectional study at a London hospital. Engl. Clin. Microbiol. Infect., 16, 1644-1648 (2010).

O. DUMITRESCU, S. BOISSET, C. BADIOU, M. BES, Y. BENITO, M.-E. REVERDY, F. VANDENESCH, J. ETIENNE, AND G. LINA. Effect of Antibiotics on Staphylococcus aureus Producing Panton-Valentine Leukocidin. Antimicrob. Agents Chemother., 51(4), 1515-1519 (2007).

M.C. LEE, A.M. RIOS, M.F. ATEN, A. MEJIAS, D. CAVUOTI, G.H. MCCRACKEN JR., AND R.D. HARDY. Management and outcome of children with skin and soft tissue abscesses caused by community-acquired methicillin-resistant Staphylococcus aureus. Pediatr. Infect. Dis. J., 23, 123-127 (2004).

L. COCHIOR, E. MIFTODE, O. DORNEANU, E. NĂSTASE, D. TEODOR, & V. LUCA. Clinical and therapeutical implications in staphylococcal infections with methicillin-resistant strains. Therapeutics, Pharmacology and Clinical Toxicology, 12(1), 133-136 (2008).

E. MIFTODE, O. DORNEANU, D. LECA, E. NASTASE, L. COCHIOR, D. TEODOR, & V. LUCA. Antibiotic resistance of Staphylococcus aureus strains isolated in Infectious Diseases Hospital Iasi. Revista Medico – Chirurgicala a Societatii de Medici si Naturalisti din Iasi, 2(3), 169-174 (2007).

G.A. POPESCU, E. NICOARA, E. MIFTODE, S. RUGINA, C. POPESCU, & E. BENEA. Supravegherea rezistentei germenilor la antibiotice – un studiu multicentric în spitale de boli infectioase. Infectio.ro., 1(2), 36-43 (2008).

M.S. DRYDEN. Skin and soft tissue infection: microbiology and epidemiology, Int. J. Antimicrob. Agents, 34(1), S2-S7 (2009).

M. BASSETTI, M. BAGUNEID, E. BOUZA, M. DRYDEN, D. NATHWANI AND M. WILCOX. European perspective and update on the management of complicated skin and soft tissue infections due to methicillin-resistant Staphylococcus aureus after more than 10 years of experience with linezolid. Clin. Microbiol. Infect., 20(Suppl. 4), 3–18 (2014).

A.F. WIDMER. Ceftobiprole: A New Option for Treatment of Skin and Soft-Tissue Infections due to Methicillin-Resistant Staphylococcus aureus, Clin. Infec. Dis., 46, 656–8 (2008).

D.L. STEVENS, A.L. BISNO, H.F. CHAMBERS, E.P. DELLINGER, E.J.C. GOLDSTEIN, SH.L. GORBACH, J.V. HIRSCHMANN, SH.L. KAPLAN, J.G. MONTOYA, AND J.C. WADE. Practice Guidelines for the Diagnosis and Management of Skin and Soft Tissue Infections: 2014 Update by the Infectious Diseases Society of America, Clin. Infec. Dis., DOI: 10.1093/cid/ciu296 (2014).

C. LIU, A. BAYER, S.E. COSGROVE, R.S. DAUM, S.K. FRIDKIN, R.J. GORWITZ, SH.L. KAPLAN, A.W. KARCHMER, D.P. LEVINE, B.E. MURRAY, M.J. RYBAK, D.A. TALAN, AND H.F. CHAMBERS. Clinical Practice Guidelines by the Infectious Diseases Society of America for the Treatment of Methicillin-Resistant Staphylococcus Aureus Infections in Adults and Children, Clin. Infec. Dis., 1–38 (2011).

C.G. GEMMELL, D.I. EDWARDS, A.P. FRAISE, F.K. GOULD, G.L. RIDGWAY AND R.E. WARREN* ON BEHALF OF THE JOINT WORKING PARTY OF THE BRITISH SOCIETY FOR ANTIMICROBIAL CHEMOTHERAPY, HOSPITAL INFECTION SOCIETY AND INFECTION CONTROL NURSES ASSOCIATION. Guidelines for the prophylaxis and treatment of methicillin-resistant Staphylococcus aureus (MRSA) infections in the UK, J. Antimicrob. Chemotherapy., 57, 589–608 (2006).

CH. ECKMANN AND M. DRYDEN. TREATMENT OF COMPLICATED SKIN AND SOFT-TISSUE INFECTIONS CAUSED BY RESISTANT BACTERIA: VALUE OF LINEZOLID, TIGECYCLINE, DAPTOMYCIN AND VANCOMYCIN, Eur. J. Med. Res., 15, 554-563 (2010).

M.S. DRYDEN. Novel antibiotic treatment for skin and soft tissue infection, Curr. Opin. Infect. Dis., 27, 116–124 (2014).

http://www.idsociety.org/Index.aspx

M.E. STRYJEWSKI AND H.F. CHAMBERS. Skin and Soft-Tissue Infections Caused by Community-Acquired Methicillin-Resistant Staphylococcus aureus, CID, 46, S368–77 (2008).

A. KALTSAS, A. GUH, J.R. MEDIAVILLA, A.K. VARSHNEY, N. ROBIOU, PH. GIALANELLIA, M. HENRY, M.H. LEVI, AND B.C. FRIES. Frequency of Panton-Valentine Leukocidin-Producing Methicillin-Sensitive Staphylococcus Strains in Patients with Complicated Skin and Soft Tissue Infection in Bronx, New York, J. CLIN. MICROBIOL., 49(8), 2992–2995 (2011).

D.P. LEVINE, R.D. CUSHING, J. JUI, W.J. BROWN. Community-acquired methicillin-resistant Staphylococcus aureus endocarditis in the Detroit Medical Center. Ann Intern Med., 97, 330–8 (1982).

H.F. CHAMBERS. The changing epidemiology of Staphylococcus aureus? Emerg Infect Dis., 7, 178–82 (2001).

S. DERESINSKI. Methicillin-resistant Staphylococcus aureus: an evolutionary, epidemiologic, and therapeutic odyssey. Clin Infect Dis., 40, 562–73 (2005).

N.F. CRUM, R.U. LEE, S.A. THORNTON, O.C. STINE, M.R. WALLACE, C. BARROZO, A. KEEFER-NORRIS, S. JUDD, K.L. RUSSELL. Fifteen-year study of the changing epidemiology of methicillin-resistant Staphylococcus aureus. Am J Med., 119, 943–51 (2006).

G.J. MORAN, A. KRISHNADASAN, R.J. GORWITZ, G.E. FOSHEIM, L.K. MCDOUGAL, R.B. CAREY, D.A. TALAN, EMERGENCY ID NET STUDY GROUP. Methicillin-resistant S. aureus infections among patients in the emergency department. N Engl J Med., 355, 666–74 (2006).

K. PURCELL, J. FERGIE. Epidemic of community-acquired methicillin resistant Staphylococcus aureus infections: a 14-year study at Driscoll Children’s Hospital. Arch Pediatr Adolesc Med., 159, 980–5 (2005).

B.C. HEROLD, L.C. IMMERGLUCK, M.C. MARANAN, D.S. LAUDERDALE, R.E. GASKIN, S. BOYLE-VAVRA, C.D. LEITCH, R.S. DAUM. Community-acquired methicillin-resistant Staphylococcus aureus in children with no identified predisposing risk. JAMA. 279, 593–8 (1998).

10E.J. GORAK, S.M. YAMADA, J.D. BROWN. Community-acquired methicillin resistant Staphylococcus aureus in hospitalized adults and children without known risk factors. Clin Infect Dis., 29, 797–800 (1999).

11CENTERS FOR DISEASE CONTROL AND PREVENTION. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus — Minnesota and North Dakota, 1997–1999. JAMA, 282, 1123–5 (1999).

2H. GRUNDMANN, M. AIRES-DE-SOUSA, J. BOYCE, E. TIEMERSMA. Emergence and resurgence of methicillin-resistant Staphylococcus aureus as a public-health threat. Lancet., 368, 874–85 (2006).

12R.C. MOELLERING JR. The growing menace of community-acquired methicillin-resistant Staphylococcus aureus. Ann Intern Med., 144, 368–70 (2006).

13M.D. KING, B.J. HUMPHREY, Y.F. WANG, E.V. KOURBATOVA, S.M. RAY, H.M. BLUMBERG. Emergence of community-acquired methicillin-resistant Staphylococcus aureus USA 300 clone as the predominant cause of skin and soft-tissue infections. Ann Intern Med., 144, 309–17 (2006).

14F.C. TENOVER, L.K. MCDOUGAL, R.V. GOERING,  G. KILLGORE, S.J. PROJAN, J.B. PATEL, P.M. DUNMAN. Characterization of a strain of community-associated methicillin-resistant Staphylococcus aureus widely disseminated in the United States. J Clin Microbiol., 44, 108–18 (2006).

15S.L. DAVIS, M.J. RYBAK, M. AMJAD, G.W. KAATZ, P.S. MCKINNON. Characteristics of patients with healthcare-associated infection due to SCCmec type IV methicillin-resistant Staphylococcus aureus. Infect Control Hosp Epidemiol., 27, 1025–31 (2006).

16B.E. GONZALEZ, A.M. RUEDA, S.A. SHELBURNE III, D.M. MUSHER, R.J. HAMILL, K.G. HULTEN. Community-associated strains of methicillin-resistant Staphylococccus aureus as the cause of healthcare-associated infection. Infect Control Hosp Epidemiol., 27, 1051–6 (2006).

17R.M. KLEVENS, M.A. MORRISON, J. NADLE, S. PETIT, K. GERSHMAN, S. RAY, L.H. HARRISON, R. LYNFIELD, GH. DUMYATI, J.M. TOWNES, A.S. CRAIG, E.R. ZELL, G.E. FOSHEIM, L.K. MCDOUGAL, R.B. CAREY, S.K. FRIDKIN, FOR THE ACTIVE BACTERIAL CORE SURVEILLANCE (ABCS) MRSA INVESTIGATORS. Invasive methicillin-resistant Staphylococcus aureus infections in the United States. JAMA, 298, 1763–71 (2007).

18C.D. SALGADO, B.M. FARR, D.P. CALFEE. Community-acquired methicillin resistant Staphylococcus aureus: a meta-analysis of prevalence and risk factors. Clin Infect Dis., 36, 131–9 (2003).

19A. SCANVIC, L. DENIC, S. GAILLON, P. GIRY, A. ANDREMONT, J.C. LUCET. Duration of colonization by methicillin-resistant Staphylococcus aureus after hospital discharge and risk factors for prolonged carriage. Clin Infect Dis., 32, 1393–8 (2001).

20M.D. SANFORD, A.F. WIDMER, M.J. BALE, R.N. JONES, R.P. WENZEL. Efficient detection and long-term persistence of the carriage of methicillin resistant Staphylococcus aureus. Clin Infect Dis., 19, 1123–8 (1994).

21R.M. KLEVENS, M.A. MORRISON, S.K. FRIDKIN,  A. REINGOLD, S. PETIT, K. GERSHMAN, S. RAY, L.H. HARRISON, R. LYNFIELD, GH. DUMYATI, J.M. TOWNES, A.S. CRAIG, G. FOSHEIM, L.K. MCDOUGAL, F.C. TENOVER AND FOR THE ACTIVE BACTERIAL CORE SURVEILLANCE OF THE EMERGING INFECTIONS PROGRAM NETWORK. Community-associated methicillin-resistant Staphylococcus aureus and healthcare risk factors. Emerg Infect Dis., 12, 1991–3 (2006).

22J.T. WEBER. Community-associated methicillin-resistant Staphylococcus aureus. Clin Infect Dis., 41(Suppl 4), S269–72 (2005).

23A.L. CAMPBELL, K.A. BRYANT, B. STOVER, G.S. MARSHALL. Epidemiology of methicillin-resistant Staphylococcus aureus at a children’s hospital. Infect Control Hosp Epidemiol., 24, 427–30 (2003).

24H.A. CARLETON, B.A. DIEP, E.D. CHARLEBOIS, G.F. SENSABAUGH, F. PERDREAU-REMINGTON. Community-adapted methicillin-resistant Staphylococcus aureus (MRSA): population dynamics of an expanding community reservoir of MRSA. J Infect Dis., 190, 1730–8 (2004).

38M.W. ELLIS, D.R. HOSPENTHAL, D.P. DOOLEY, P.J. GRAY, C.K. MURRAY. Natural history of community-acquired methicillin-resistant Staphylococcus aureus colonization and infection in soldiers. Clin Infect Dis., 39, 971–9 (2004).

52H.A. COOK, E.Y. FURUYA, E. LARSON, G. VASQUEZ, F.D. LOWY. Heterosexual transmission of community-associated methicillin-resistant Staphylococcus aureus. Clin Infect Dis., 44, 410–3 (2007).

35E.M. BEGIER, K. FRENETTE, N.L. BARRETT, P. MSHAR, S. PETIT, D.J. BOXRUD, K. WATKINS-COLWELL, S. WHEELER, E.A. CEBELINSKI, A. GLENNEN, D. NGUYEN, J.L. HADLER, CONNECTICUT BIOTERRORISM FIELD EPIDEMIOLOGY RESPONSE TEAM. A high-morbidity outbreak of methicillin-resistant Staphylococcus aureus among players on a college football team, facilitated by cosmetic body shaving and turf burns. Clin Infect Dis., 39, 1446–53 (2004).

49H.C. BAGGETT, T.W. HENNESSY, K. RUDOLPH, D. BRUDEN, A. REASONOVER, A. PARKINSON, R. SPARKS, R.M. DONLAN, P. MARTINEZ, K. MONGKOLRATTANOTHAI, J.C. BUTLER. Community-onset methicillin-resistant Staphylococcus aureus associated with antibiotic use and the cytotoxin Panton-Valentine leukocidin during a furunculosis outbreak in rural Alaska. J Infect Dis., 189, 1565–73 (2004).