1 A BIOCHEMICAL STUDY ON SOME BIOMARKERS OF COLORECTAL CANCER Thorya El -Deeb1, Amany Osama1, Doaa W. Maximous2, Osman M. Essam 1, Michel E. Fakhry1… [600706]

1 A BIOCHEMICAL STUDY ON SOME BIOMARKERS OF
COLORECTAL CANCER
Thorya El -Deeb1, Amany Osama1, Doaa W. Maximous2, Osman M. Essam 1,
Michel E. Fakhry1
Medical Biochemistry Department , Faculty of Medicine, Assiut University1
Surgical Oncology Department , South Egypt Cancer Institute, Assiut University2
ABSTRACT
Up till now, there is still no ideal tumor marker for early diagnosis and effective
monitoring, especially for patients who undergo surgical resection of colorectal cancer
(CRC) . The aim of this study is to evaluate the clinical utility of serum desmin level, plasma
level of nicotinamide N -Methyl transferase (NNMT) activity, urinary 8 -Hydroxy 2' –
DeoxyGuanosine (8OHdG) level, and the presence of Long DNA in stool as novel diagnost ic
biomarkers to be used for the purpose of screening for CRC , as well as their role in follow up
after treatment for early detection of recurrence , as compared to the routinely used markers as
carcinoembryonic antigen ( CEA ) and the presence of fecal occult blood . This study was
conducted on 70 subjects that included 50 patients with CRC (Group I), 20 of these patients
that could be followed up for 1 year after operation (Group II) and 20 appare ntly healthy
subjects (Group III ). Morning urine , stool and blood samples were collected , for assay of
serum desmin level, serum CEA level by ELISA, plasma level of NNMT activity by
fluorometric method , urinary 8OHdG level by HPLC , searching for the presence of Long
DNA in stools by PCR and rapid test for detection of fecal occult blood. The levels of the
measured serum desmin, plasma NNMT enzyme activity, urinary 8OHdG in group I were
significantly higher than those of group II or grou p III . Moreover , their levels were
significantly higher in the recurrent cases of group II . A significant positive correlation was
found between the levels of these new biomarkers with CEA , Long DNA was found in the
stool of 95% of group I patients . Conclusion: Serum desmin, plasma NNMT, urinary 8OHdG
and the presence of Long DNA are satisfactory diagnostic biomarkers of CRC. Moreover,
serum desmin, plasma NNMT, and urinary 8OHdG are apparently valuable in postoperative
monitoring of CRC patients.
INTRODUCTION :
Colorectal cancer (CRC) is the third most common cancer worldwide after lung and
breast cancers with two -thirds of all CRCs occurring in the more developed regions of the
world. In Egypt, it contributes for 5.0 % of all cancers. Each year there are nearly one million
new cases of CRC diagnosed worldwide and half a million deaths (Elsabah and Adel, 2013
& Gado et al., 2014). Although being an invasive procedure, colonoscopy -guide d biopsy is
considered as the gold standard for cancer colon diagnosis, in spite of its high cost and
inconvenience (Atkin et al., 2013 & van Dam et al., 2013) . On the other hand, the nowadays
applied tumor markers, carcinoembryonic antigen (CEA) and CA19 -9 have shown poor

2 sensitivity and specificity for early diagnosis of CRC, as wel l as in judging the effectiveness
of the surgical resection of the tumor (Hawk and Levin, 2005 & Struck et al., 2011) . These
facts have prompted the search for other non -invasive reliable markers for the disease to
enhance screening acceptance and efficacy in detecting CRC at an earlier and curable stage.
(Quintero et al., 2010).
Desmin is a 52 -kDa protein with a wide variety of functions. It is expressed in cardiac,
skeletal and smooth muscle cells. Is is encode d by a single gene on chromosome 2q35
consisting of nine exons and eight introns within a 8.4 kb region encoding 476 amino acids.
(Li et al., 1996) . It has been confirmed that desmin is one of the earliest protein markers for
muscle tissue in embryogenesis as it is detected in the somites of myoblasts (Bär et al.,
2004) . Several studies have shown that desmin is a highly sensitive marker for endothelia l
cell differentiation and tumor invasiveness in several types of cancers, including colon cancer
(Jiang et al., 2008) . Using double -immunostaining , Arentz et al. (2011) found different
populations of cells within the CRC tumor stroma; most of these cells were staining positive
for the presence of desmin confirming desmin expression from myofibroblasts within CRC
tumor stroma . These tumor stromal myofibroblasts play a piv otal role in the switch from non –
invasive to invasive cancer, also Arentz et al. (2011) found strong focal desmin expression in
stroma directly adjacent to carcinomatous glands and microvessels. These cells showed co –
localisation of desmin and vimentin in close association with cells expressing von Willebrand
Factor ( VWF ), indicating that they were pericytes. Significantly higher levels of desmin –
positive pericytes were observed in late stage tumors, consistent with increased angiogenesis.
They concluded th at desmin expression in CRC stroma correlates with advanced stage disease
and marks angiogenic microvessels. (Arentz et al., 2011)
Nicotinamide N -methyltransferase (NNMT) (EC 2.1.1.1) is an S -adenosyl -L-methionine
dependent enzyme that catalyzes the methylation of nicotinamide and other pyridines to form
pyridinium ions. NNMT was first identified by cDNA cloning from the liver and the protein
is predicted to be present in the cytosol. It is characterized as a monomer protein of 264 amino
acids with a molecular weight of 29.6 kDa (Aksoy et al., 1995) . NNMT, normally is present
mainly in the liver but is also found in other organs such as kidney, lung, placenta, heart,
brain, tumor cells and adipose tissue (Kim et al., 2009) . Interestingly, significant up
regulation of NNMT was de monstrated in numerous diseases (Debigarè et al., 2008 &
Mateuszuk et al., 2009) . The abnormal expression of NNMT has been identified in several
types of tumors, such as glioblastoma (Markert et al., 2001) , stomach adenocarcinoma (Lim
et al., 2006) , papillary thyroid cancers (Xu et al., 2005) , renal carcinoma (Sartini et al.,
2006) , oral squamous cell carcinoma (Sartini et al., 2007) , colorectal cancer (Roeßler et al.,
2005) , hepatocellular carcinoma (Kim et al., 2009) , bladder cancer (Wu et al., 2008) , lung
cancer (Tomida et al., 2009) and pancreatic cancer (Rogers et al., 2006) . In numerous
studies, an up -regulation of NNMT or an increase in NNMT -deriv ed methyl nicotinamide
(MNA) formation was suggested to be a novel disease biomarker (Kim et al., 2009 &
Tomida et al., 2009) . Some authors suggest a pathological role of NNMT dependant
pathways in various diseases (Wu et al., 2008) , others suggest a beneficial role (Mateuszuk
et al., 2009) . Although the mechanisms of the regulation of NNMT expression are largely

3 unknown, Tomida et al., (2008) showed that in human cancer cells, NNMT expression is
regulated by signal transducer and activator of transcr iption 3 (Stat3). Experimental data
suggest s that NNMT plays a critical role in the proliferation and tumorigenic capacity of oral
cancer cells, and its inhibition could represent a potential molecular approach to the treatment
of oral carcinoma (Pozzi et al., 2013) . Furthermore, it has been proved that NNMT is
necessary for cancer cell migration (Wu et al., 2008) and cellular invasion (Tang et al.,
2011) . Xie et al., (2014) investigated the effects of NNMT over -expression on tumorigenesis
of CRC. Their results indicated that NNMT enhances the capacity of tumorigenesis associated
with the inhibition of cell apoptosis and the promotion of cell cycle progression in human
colorectal cancer cells and the 1 -methylnicotinamide increased by NNMT media tes the
cellular effects of NNMT in cells. They concluded that NNMT may play a vital role in
tumorigenesis of CRC, energy balance and ROS induction. (Xie et al., 2014)
Stool -based screening tests are an attractive alternative for many screen -eligible peopl e
because they do not require a cleansing bowel preparation or need to miss work, are non –
invasive, and can be done in the privacy of the home. In parts of the world where colonoscopy
resources are limited, stool -based tests, which to date have been based on de tecting fecal
occult blood (FOB ), remain the foundation of CRC screening. Although, this approach
reduces CRC mortality by one -third when the test is performed annually, it has limited
sensitivity and specificity for CRC, and rel ies on patients comply ing with annual screening
(Launois et al., 2014) . Newer stool tests include fecal immunochemical tests (FIT) and stool
DNA tests (Stracci et al., 2014) . Large -scale screening studies of previously available stool –
based DNA tests showed only fair sensitivity for the detection of colorectal cancer (Imperiale
et al., 2014) . A variety of fecal molecular markers, including mutations of oncogenes and
tumor suppr essor genes, microsatellite instability and microRNA and DNA methylation may
increase the sensitivity of CRC screening (Zhang et al., 2015) . In particular, the fecal long
DNA assay present s a valid and a reliable method for the detection of CRC (Zhang et a l.,
2015) . Whereas the majority of mucosal tissues lose cells to apoptosis, transformed colonic
mucosa cells have dysfunctional apoptotic mechanisms w ith decreased rate of apoptosis that
may lead to shedding of cells that have not undergone apoptosis (Zhang et al., 2015) .
Because one of the characteristics of apoptosis is the cleavage of DNA into 180 – to 21 0-bp
fragments (Shanmugatha san and Jothy , 2000) , the presence of high -molecular -weight
fragments detected by the examination of DNA integrity in stools may indicate that a certain
population of cells has escaped apoptosis -induced DNA degradation and these cells are most
probably neoplastic . Tumor cells that have escaped apoptosis and are necrotic may constitute
many of the ce lls shed into the colonic lumen (Boynton et al., 2 003). So, Long or high –
molecular weight DNA (L -DNA), appears to reflect the presence of non -apoptotic
colonocytes, which are characteristically exfoliated from neoplasms (Strater et al., 1996) .
Thus, amplification of human DNA fragments in stool longer tha n 200 base pairs should
serve as markers for CRC neoplasia. Present methods for detecting long DNA use assay of
multiple -specific target sequences on different genes. Assay of Alu sequences represents a
potentially simple approach to measure human long DNA in stool. Alu sequences embody the
largest family of middle repetitive DNA sequences in the human genome. An estimated half
million Alu copies are present per haploid human genome. Because Alu sequences are so

4 abundantly distributed throughout the genome and specific to the genomes of primates, an
assay that amplifies DNA sequences longer than 200 bp within these 300 -bp repeats should
provide a genome -wide approach to detect the presence human long DNA in stool (Zhang et
al., 2015) . In their study, Zou et al., (2006) used real -time PCR amplification of a 245 -bp
sequence within Alu repeats to quantify human long DNA in stool and they found that human
long DNA levels were significantly higher in stools from CRC patients than from normal
individuals. This meth od may have advantages of simplicity and speed compared with other
approaches that describe use of multiple gene targets to assay long human DNA in stool. (Zou
et al., 2006)
In living cells reactive oxygen species (ROS), including superoxide anion radical( O2•-),
hydrogen peroxide (H2O2), hydroxyl radical (OH•), are formed continuously as a
consequence of metabolic reactions. Nuclear and mitochondrial DNA from tissue and blood
lymphocyte is usually the site of oxidation damage (Krystonet al., 2011) . The oxid ative
hydroxylati on of guanine in the 8 -position, resulting in the formation of the modified
nucleoside 8 -hydroxy 2' -deoxyguanosine (8 -OHdG), is the most frequent and most mutagenic
lesion in nuclear DNA. Oxidative damage to DNA, reflected in the formation of 8-OHdG, is
important in mutagenesis and carcinogenesis (Płachetka et al., 2013) . Many observations
suggest the role of oxidative stress in CRC pathogenesis. Higher levels of oxidative
modifications in DNA were observed in carcinoma cells than in the corresponding normal
mucosa based on 8 -OHdG determination, meaning that CRC cells are exposed to more
oxidative stress than their corresponding non neoplastic epithelial cells and that oxidative
stress in carcinoma cells might stimulate cellular proliferation (Płachetka et al., 2013) .
Moreover, Chang et al., (2008) reported that serum leve l of 8 -OHdG can act as a sensitive
biomarker for colorectal carcinoma. Furthermore, it was found that the excretion levels of
urinary 8 -OHdG in CRC patients were significantly higher than those in healthy persons, and
that cancer patients who had undergone surgical therapy and chemotherapy showed a
significant decrease in urinary 8 -OHdG (Mei et al., 2005) . This sugge sts the possible
involvement of oxidative stress in colorectal cancer and indicate s that oxidized urinary
nucleosides may be useful biomarkers for that disease (Hsu et al., 2009) .
Accordingly, the aim of the present study is to evaluate the clinical utility of serum
desmin level, plasma level of ncotinamide N -methyl transferase (NNMT) activity, urinary 8 –
Hydroxy 2' -DeoxyGuanosine (8 -OHdG) level, and the presence of Long DNA (L -DNA) in
stools as novel diagnostic biomarkers to be used for the purpose of screening for CRC, as well
as their role in follow up after treatment for early detection of recurrence, as compared to the
routinely u sed markers, carcinoembryonic antigen (CEA ) and the presence of f ecal occult
blood (FOB) .
SUBJECT S AND METHODS
This study was conducted on 70 subjects, 50 operable colorectal cancer patients and 20
apparently healthy age and sex matched volunteers as controls . The CRC patients were
admitted to the South Egypt Cancer Institute, Surgery Department, Assiut University from

5 October, (2009 ) to June, (2012 ). All participants granted their consent to share in this study.
The subjects were divided into 3 groups :
Group I: Included 50 CRC operable patients before operation (25 males and 25 females)
their ages ranged 38 -71 years old .
Group II: Included the same previous operable 50 patients after operation and treatment
which included radical surgery combined with either chemotherapy or radiotherapy. Urine
and blood samples were collected from them after 6 months of treatment and they were
followed up for recurrence for 1 year. We tried to follow up all the patients, but we could
finally follow up only 20 patients for one year. The other 30 patients couldn't be followed up
because of their death or inability of commun ication with them.
Group II I: Included 20 apparently healthy age and sex matched volunteers as controls.
They were recruited from staff or patient relatives and screened using careful history and
examination, as well as basic blood tests.
Exclusion criteria included: the presence of any history of previ ous tumors , receiving any
anticancer therapy or undergoing surgical operations for tumor resection, patients with family
history of colorectal cancer or patients who are unfit for surgery.
All patients were subjected to complete medic al history taking, c omplete clinical
examination, Computed Tomography (CT) scan, Colonoscopy . Venous blood samples, stool
samples and urine samples were collected from group I and III subjects. Venous blood
samples and urine samples only were collected from group II patients .
Approximately 6 ml of blood was withdrawn from the antecubital vein of every subject
and was divided into two tubes , 3 ml of blood was transferred into plain tube, centrifuged and
the clear supernatant serum was stored frozen at −20°C to allow batch analysis for CEA and
Desmin. The remaining 3 ml of blood was transferred into EDTA tubes, centrifuged and
separated to obtain plasma sample s that were stored at -20°C till time of analysis for
determination of NNMT enzyme activity.
Early morning urine samples were taken from all subjects and stored at −20 °C in the dark
till time of analysis of the concentration of 8 -OHdG.
Stool samples , from CRC patients before operation and from healthy controls, were
collected before colonoscopy or purgative bowel cleansing. Only 20 patients of the 50
patients could give stool samples. Othe r patients had constipation. Each sample was divided
into 2 portions ; one portion was processed immediately for determination of the presence of
fecal occult blood. To the other portion buffer containing EDTA was adde d to inhibit DNase
and stored frozen at -60 °C to be analyzed for the presence of L -DNA by PCR.

6 Determination of seru m CEA concentration :
Serum CEA concentration was determined by using Human CEA ELISA kit (CEA
AccuBind™ ELISA test system); product code: 1825 -300, supplied by Monobind Inc. Lake
Forest, CA 92630, USA . (Thomas et al., 1990)
Determination of serum Desmin concentration:
Serum desmin concentration was determined by using Human Des (Desmin) ELISA kit;
Provided from Elabscience Biotechnology Co., Ltd; Catalog No: E -EL-H1505 96T ; Building
4, Room 403, Guandong Science and Technology Industry Park, Wuhan, Hubei Province,
P.R. China. (Kobayashi et al., 2011)
Determination of plasma NNMT enzyme activity:
To evaluate the activity of NNMT, plasma samples were assayed for the enzymatic
conversion of 4 -methylnicotinamide (4 -MNA) to 1,4 -dimethylnicotinamide (1,4 -MNA) by
the modified fluorometric method of Sano et al., (1989). The method consists of a
determination of the product, 1,4 -MNA where 4 -MNA is the methyl acceptor substrate in the
presence of cofactor S -adenosyl -L-methionine (SAM). The reaction mi xture consisted of 12.5
µl of 2 mM dithiothreitol, 12.5 µl of 0.8 M Tris -HCl buffer (pH = 8.6), 25 µl of 16 mM 4 –
MNA (4 -methylnicotinamide), 50 µl of 0.4 mM AdoMet (S -adenosyl Methionine) i n 0.1 mM
sulfuric acid and 100 µl of the plasma. The mixture was incubated at 37°C for 80 min. The
enzyme reaction was terminated by heating in a boiling water bath for 2 min. To prepare the
blank, the same procedure was used but the reaction was stopped i mmediately without
incubation. Reaction mixtures were centrifuged at 13,000 × g for 5 min at room temperature.
A 100 µl aliquot of the supernatant was poured into 1.5 ml stopper test tubes containing 1 ml
of 0.02 M 4 -methoxybenzaldehyde in 35% (v/v) aqueou s ethanol and 100 µl of 0.5 M
aqueous sodium hydroxide. The tube was heated in a boiling water bath for 15 min. After
cooling, the mixture was centrifuged again at 13,000 × g for 10 min at room temperature. The
fluorescence intensity was measured with exci tation at 418 nm and emission at 490 nm. To
quantify the reaction product, 1,4 -MNA was calculated using a calibrating curve for 1,4 –
MNA at the concentration range 100 -1000 pg/ml where the curve was linear. All used
chemicals were purchased from Sigma (Sigm a-Aldrich, Inc. 3050 Spruce Street, St Louis,
MO 63103, USA). (Sano et al., 1989)
Determination of urinary 8 -OHdG level:
Urinary creatinine concentration was first determined by a colorimetric kinetic method
using Stanbio direct creatinine liquicolor kit (Procedure No. 0420) supplied from Stanbio
Laboratory, 1261 North Main Street; Boerne, Texas, USA . Then, urina ry 8-OHdG level was
determined by High Performanc e Liquid Chromatography (HPLC) at Analytical Chemistry
Unit, Faculty of Science, Assiut Universit y. Urinary 8 -OHdG was first extracted by solid
phase extraction method by the consecutive procedure of C18 and cation exchanger SCX
columns. This is followed by the determination of 8 -OHdG level by isocratic HPLC –
Electroc hemical detection (ECD) system (Agilent Technologies, Deutschland GmbH,
Hewlett -Packard -Strasse 8, 76337 Waldbronn, Germany) according to the method described
by Inaba et al., (2011) . Finally, the concentrations of 8 -OHdG were expressed as ng/mg
creatinine.

7 Method for detection of fecal occult blood:
This was done by advanced quality rapid FOB test c ards provided from InTec Products ,
INC., 332, Xinguang Rd, Xinyang IND Area, Haicang, Xiamen, 361022, China. The
advanced quality rapid FOB Test is a rapid, serological, immunochromatographic assay for
detection of hemoglobin (Hb) in human feces.
Method for detection of stool L -DNA:
– Fecal DNA extraction
This was done by Isolate Fecal DNA kit from Bioline Co., catalogue no. BIO -52038,
Meridian Bioscience Asia Pte Ltd., Unit#03 -24 & #03 -25; The Aquarius 21 Science Park
Road, Singapore Science Park II, Singapore.
– PCR amplification of Alu sequences for detection of L -DNA
The Alu sequence consists of co ++nserved regions and variable regions. In the putative
consensus Alu sequence, the conserved regions are the 25 -bp span between nucleotide
positions 23 and 47 and 16 -bp span between nucleotide positions 245 and 260 (Kariya et al.,
1987) . Primers specific fo r the human Alu sequences were used to amplify sequences about
245 bp inside Alu repeats [sense (5'ACGCCTGTAATCCCAGCACTT3') and antisense
(5'TCGCCCAGGCTGGAGTGCA3')]. Primers were purchased from InvitrogenTM by life
technologies, UK. The primers were checke d for specificity using BLAST (Basic Local
Alignment Search Tool) (http://www.ncbi.nlm.nih.gov/BLAST). PCR amplification of 245 bp
inside Alu repeats was carried out under the following conditions: 95 șC for 5 minutes
followed by 35 cycles of 95 șC for 1 mi nute and 49 șC for 1 minute and 72 șC for 1 minute
followed by 72 șC for 7 minutes in the thermal cycler (Applied Biosystems® Veriti® Thermal
Cycler, Life technologies, Singapore) (Mullis et al. , 1987) .
– Detection of L-DNA by agarose gel electrophoresis:
Presence of L -DNA was identified by electrophoresis of PCR products in 2% agarose gel
stained with ethidium bromide, t he size of amplified DNA product was compared with the
ladder of DNA fragments produced by the marker. Positive samples for L -DNA containe d
single band (~ 245 bp). (Williams and Rapley, 2000)
– Statistical analysis:
Data collected were analyzed by computer program SPSS" ver. 21" Chicago. USA. Data
expressed as mean, Standard error and number, percentage. Mann -whitney w as used to
determine significance for numeric variable s. Chi. Square (χ2) was used to determine
significance for categorical variable s. Paired T test was used to compare between levels of
investigated markers before and after operation and treatment in CRC patients. Pearson's
correlation was used for correlations between groups.
n.s. P>0.05 non -significant. *P< 0.05 significant. **P<0.001 moderately significant.
***P<0.000 highly significant.
RESULTS
There is a highly significant difference (P<0.000) between CRC patients be fore operation
and control groups in CEA, Desmin , NNMT and urinary 8-OHdG levels . Also, there is a
highly significant difference (P<0.000) between CRC patients after 6 months of treatment and

8 control groups in CEA, 8 -OHdG and a moderate significant difference between CRC patients
after 6 months of treatment and control groups in Desmin level (P<0.001) . But, there is non
significant difference between CRC patients after 6 months of treatment and control groups
as regards plasma NNMT enzyme activity (P>0.05). (Table 2)
There is a highly significant difference (P<0.000) in CEA, Desmin, NNMT and urinary 8 –
OHdG levels in CRC patients before operation and after 6 months of treatment. (Table 3)
Comparing between different markers levels in recurrent and non -recurrent cases within
one year after treatment, levels of Desmin, NNMT, urinary 8 -OHdG before operation was
higher in recurrent cases than in non recurrent cases but with non significant difference
(P>0.05). On the oth er hand, the levels of CEA , Desmin, NNMT and urinary 8 -OHdG after 6
months of treatment was significantly higher in recurrent cases than in non recurrent cases
with moderate significance difference (P<0.001). However, these data did not reach a
statistica lly significant level because of the small sample size. (Table 4)
There is a highly significant difference (P<0.000) as regards the presence of FOB and
stool L -DNA between CRC patients before operation and control group. (Table 5)
Table (6) shows the sensi tivity and specificity of these different biomarkers in detecting
CRC as measured in our study.
Studying correlation between markers before treatment , we found that, there is positive
correlation between CEA and Desmin, between CEA and NNMT, and between Desmin and
NNMT . (Figures 1, 2, 3)
Studying correlation between markers after treatment, we found that, there is positive
correlation between CEA and Desmin, and between CEA and NNMT. (Figures 4, 5 )
Table (1): Comparison between d emographic data in CRC pat ients & control subjects .
Item CRC patients
group “n=50” Control group
“n=20” P-value
1- Age ―years
Mean ±S E
2- Sex:
 Male
 Female
54.98± 1.38

25(50.0%)
25(50.0%)
57.70± 1.44

10(50.0%)
10(50.0%)
P=0.255n.s

P=0.604n.s
Table (1) shows non significant difference between CRC patients and control subjects
(P>0.05) as regards age and sex.

9 Table (2): Comparison between the investigated markers in CRC patients & control subjects
(mean ± SE).
Item CRC patients
group “n=50” Control
group ,n=20 P-value
1- CEA “before ” (ng/ml)
2- CEA “After” (ng/ml)
3- Desmin “before” (ng/ml)
4- Desmin “After” (ng/ml)
5- NNMT “before” (pg/ml)
6- NNMT “After” (pg/ml)
7- Urinary 8-OHdG “before” (ng/mg creatinine)
8- Urinary 8-OHdG “After” (ng/mg creatinine) 181.41±22.12
40.31±21.67
118.63±49.65
52.06±8.99
497.19±14.63
217.51±23.19
54.48±10.22
31.07±13.83 3.81±0.33
3.81±0.33
35.59±2.05
35.59±2.05
235.44±11.64
235.44±11.64
9.80±13.83
9.80±13.83 P<0.000***
P<0.000***
P<0.000***
P<0.001**
P<0.000***
P=0.485n.s
P<0.000***
P<0.000***

Table (3): Comparison between the investigated markers before &after treatment in CRC
patients .
Item CRC patients
group Before
“n=20” CRC patients
group After
“n=20” Paired t -test P-value
 CEA (ng/ml)
 Desmin (ng/ml)
 NNMT (pg/ml)
 Urinary 8 -OHdG
(ng/mg creatinine) 169.31±30.49
117.82± 45.89
498.31 ±20.93
54.37 ±17.32 40.31±21.67
52.06±8.99
217.51±23.19
31.07±13.83 t= 3.132
t= 4.72
t= 8.78
t= 9.92 P<0.00 1**
P<0.000***
P<0.000***
P<0.000***

10 Table ( 4): Comparison between the investigated markers in recurrent and non – recurrent
cases within one year after treatment.
Item +ve recurrence
“n=3” -ve. recurrence
“n=17” P-value
1-CEA “before” (ng/ml)
2-CEA “After” (ng/ml)
3-Desmin “before” (ng/ml)
4-Desmin “After” (ng/ml)
5-NNMT “before” (pg/ml)
6-NNMT “After” (pg/ml)
7- Urinary 8 -OHdG “before” (ng/mg
creatinine)
8- Urinary 8 -OHdG “After” (ng/mg
creatinine) 142.22±52.05
176.08±122.9
125.64±21.35
107.57±44.43
503.85±49.34
360.90±91.02
61.54±11.66

37.02±1.124 174.09±35.06
16.36±9.16
116.44±11.67
42.26±5.42
497.33±23.62
192.20±17.37
53.11±18.70

30.02 ±1.47 P=0.720n.s
P<0.005**
P=0.758n.s
P<0.006**
P=0.915n.s
P<0.006**
P=0.082n.s

P<0.03*

Table (5): Comparison between the presence of FOB, and stool L -DNA in CRC patients
before operation & control subjects .
Item CRC patients
group “n=20” Control group
“n=20” P-value
FOB before operation:
 Positive
 Negative
18(90.0%)
2(10.0%)
2(10.0%)
18 (90.0%)
P<0.000***

L-DNA before operation:
 Positive
 Negative
19(95.0%)
1(5.0%)
2 (10.0%)
18(90.0%)
P<0.000***

Table (6): Sensitivity and specificity of biomarkers.
Item Sensitivity Specificity
CEA (cutoff=4.47ng/ml) 100% 70%
Desmin (cutoff=39.69ng/ml) 100% 70%
NNMT (cutoff=258.72pg/ml) 100% 50%
Urinary 8 -OHdG (cutoff=37.46ng/mg creatinine) 100% 0.0
FOB 90% 90%
L-DNA 95% 90%

11
Figure (1) shows positive correlation between CEA and Desmin before operation (r=0.859)
(P<0.000***)

Figure (2) shows positive correlation between CEA and NNMT before treatment (r=0.855)
(P<0.000***) .

12

Figure (3) shows positive correlation between Desmin and NNMT before treatment (r=0.940)
(P<0.000***) .

Figure (4) shows positive correlation between CEA and NNMT after treatment (r=0.907)
(P<0.000***) .

13
Figure (5) shows positive correlation between CEA and Desmin after treatment (r=0.966)
(P<0.000***) .

Figure (6): Shows the agarose gel electrophoresis for L -DNA :
Lane 1 represents ladder DNA (100bp)
Lanes 2 -7 represent positive samples for the presence of L -DNA (245bp)
Lane 8 represents negative samples for the presence of L -DNA.

14 DISCUSSION
The early detection of colorectal cancer (CRC) is one of the great challenges in combating
that disease. There are almost 1 million new cases every year all -over the world, and almost
half a million die of CRC. The disease is asymptomatic in the initial stages in the majority of
cases; around 45 % of cases are detected in an a dvanced stage (Cavia -Saiz et al., 2014) .
Various biomarkers such as CA19 -9 and CA242 for CRC diagnosis are available, and CEA is
the most commonly used. CEA is the established and the best single tumor marker for CRC.
Since C EA was discovered as a cancer marker in 1965, no biomarker has been established
that fulfills the requirements with sufficiently high sensitivity and specificity for early
detection of CRC, and to date no novel marker could displace CEA in the detection of the
CRC. However, CEA lacks sensitivity as well as specificity for screening an average risk
population, and its diagnostic role remains controversial, so CRC is often diagnosed at late
stages. In contrast, early stage CRC is associated with prolonged sur vival following surgical
resection of the tumor. Thus, along with the advances in treatment, the development of new
tools to diagnose CRC in the early stages could lead to a great reduction in the mortality due
to CRC. One of the current objectives in the field of cancer is the study of biomarkers for the
early detection of colorectal cancer (Ma et al., 2009) . In the present study, we compared
validity of some proposed new biomarkers with routine known markers; CEA and fecal occult
blood test.
It is well kn own that s ome high diagnostic value biomarkers of cancer have embryonic origin.
Indeed , it has been widely observed that these genes and proteins are shared between the
processes of embryogenesis and tumorigenesis (Hendrix et al., 2007 ). The mechanisms of
colorectal development and CRC progression are similar in the processes of mitosis and
differentiation, and comparable events are observed during the initiation and progression of
CRC (Lee et al., 2008 ). Desmin is one of the proteins that are highly expres sed in the fetus
and CRC tissues compared with normal tissue (Ma et al., 2009) . According to this theory, we
measured the level of desmin in the serum of CRC patients and healthy controls. As a
benchmark, we also , assessed serum levels of CEA, the establis hed tumor marker for CRC.
Mean serum levels of CEA were elevated from 3.81±0.33 ng/ml in healthy controls to 181.41
± 22.12 ng/ml in CRC patients before operation and decreased to 40.31 ± 21.67 ng/ml in
CRC patients after 6 months of operation and recei ving treatment. CEA levels were
significantly higher during follow up in recurrent cases (176.08±122.9 ng/ml ) compared to
non-recurrent cases (16.36±9.16 ng/ml ). Using 4.47ng/ml as a cutoff level or CEA in our
study, it showed 100% sensitivity and 70% specificity. With regard to desmin, we found a
strong elevation of desmin in the blood of CRC patients before operation. The mean serum
level for desmin was 3.3 times significantly higher in the CRC p atients before operation
(118.63 ± 49.65 ng/ml) compared with healthy controls (35.59 ± 2.05 ng/ml) and the levels
decreased significantly after 6 months of operation and receiving treatment to 52.06 ± 8.99
ng/ml . Also, serum Desmin levels were significant ly higher during follow up after 6 months
of operation and treatment in recurrent cases (107.57±44.43 ng/ml ) compared to non -recurrent
cases (42.26±5.42 ng/ml ), the levels of serum Desmin were non -significantly higher in the
preoperative samples in the rec urrent cases (125.64±21.35 ng/ml ) compared to the non –
recurrent cases (116.44±11.67 ng/ml ) but these data concerning recurrent cases did not reach

15 a statistically significant level because of the small sample size (3 recurrent cases). Using
39.69ng/ml as a cutoff level for Desmin in our study, it showed 100% sensitivity and 70%
specificity. Th ese findings denoted that there is a comparable diagnostic and prognostic
performance between CEA and desmin based on our preliminary analysis.
Our results are in ag reement with those of Ma et al. (2009) who reported a significant
increase of desmin expression in CRC tissues compared with normal colorectal tissue. Higher
expression of desmin correlated with severity of the lesion, from normal colorectal tissue to
aden oma, CRC, and metastasis. Afterward, the authors tested serum desmin levels in 92 CRC
patients and 45 healthy controls. The level of desmin expression was significantly higher in
CRC patients than in healthy controls. Serum d esmin levels were not related t o cancer stage.
The diagnostic accuracy of serum desmin was compared with that of CEA, showing
comparable performance for both markers (Ma et al., 2009) .
Several studies have shown that Desmin is a highly sensitive marker for endothelial cell
differentiation and tumor invasiveness in many types of cancers, including colon cancer
(Jiang et al., 2008) , and gastrointestinal stromal tumors (Liegl et al., 2009) . Jiang et al.,
(2008) demonstrate d that the colon cancer -specific gene network captured important genetic
interplays in several cellular processes such as differentiation, mitogenesis, proliferation,
apoptosis, inflammation and immunity that are known to be pivotal for tumorigenesis. They
identified Desmin gene to be one of the central elements in the gene network specific to colon
cancer (Jian g et al., 2008)
Our results concerning Desmin also agreed with those of Arentz et al. (2011) who found
over-expression of desmin in CRC tissues and using immunostaining, and located desmin to
pericytes of CRC linking over -expression of desmin in CRC tissues to increased angiogenesis
and t hey concluded that desmin expression in CRC stroma correlates with advanced stage
disease and marks angiogenic microvessels (Arentz et al., 2011) .
Therefore, desmin could be a sensitive, and specific marker that assists in the detection of
CRC. However, more patient sera are needed to be tested, including pre – and postoperative
samples, samples from patients with o ther cancers, etc., to understand the potential value of
this new biomarker.
In addition, we determined the plasma NNMT activity. The mean NNMT activity in
healthy controls was 235.4 4±11.64 pg/ml . For the patients with CRC before operation, a
mean level of 497.19±14.63 pg/ml was found. The difference between healthy controls and
patients with colorectal cancer before operation was highly significant. The levels decreased
significantly after 6 months of operation and treatment to be 217±23.19 pg/ml to reach level
that has a non significant difference from control group. P lasma NNMT levels after 6 months
of operation and treatment in recurrent cases were significantly higher than non -recurrent
cases. Also, the preoperative plasma NNMT activity in recurrent cas es were higher than those
in non -recurrent cases but with no significant statistical difference. Results concerning
recurrent cases did not reach statistical significance level due to small sample size (3 cases).
Using 258.72 pg/ml level as a cutoff value for NNMT in our study, it showed 100%
sensitivity and 50% specificity.

16 Our results are in accordance with the results of Roeβler et al. (2005) who employing
two-dimensional gel electrophoresis and mass spectrometry, analyzed 16 matched colorectal
cancer and adjacent normal tissue samples. They found s trong elevation in colorectal cancer
for five proteins including NNMT . They measured NNMT levels in CRC patient’s serum
samples and found e levated levels of NNMT in serum from patients with CRC compared to
normal controls . This was the first report to show a correlation of NNMT plasma levels with
the presence of colorectal cancer. NNMT showed a highe r sensitivity than CEA in the
detection of colorectal cancer (Roeβler et al., 2005)
We observed a considerable overlap of NNMT levels in apparently healthy donors and
patients with colorectal cancer. This also was matching with the results of Roeβler et al .,
(2005) . Because NNMT is predominantly expressed in the liver (Askoy et al., 1994 ), one
possible cause for elevated NNMT serum levels may be the presence of occult liver disease in
apparently healthy donors. In line with this possibility is the finding of abnormal nicotinamide
metabolism and elevated levels of N -methylnicotinamide in pa tients with hepatic cirrhosis.
Further studies are needed to elucidate a potential correlation of NNMT serum levels with
other diseases, such as liver diseases or other cancers.
Our results could be explained by over -expression of NNMT in CRC tissues which were
observed and explained by Tomida et al. (2008). Although the mechanisms of the regulation
of NNMT expression are largely unknown, Dauer et al. (2005 ) showed that Stat3 regulates
genes common to both wound healin g and cancer. So, Tomida et al., (2008 ) aiming to
discover new molecular targets for cancer therapy and diagnosis, they investigated the Stat3 –
regulated genes in different cancer cells with cDNA microarray analysis and found that
NNMT expression was induce d on stimulation of the cells with leukemia inhibitory factor
which activates Stat -3. In colon cancer cells, they found that NNMT expression increased on
stimulation of the cells with interleukin 6 which also , activates Stat -3. Their results also ,
showed t hat colon cancer cells expressed constitutively a high level of NNMT. Treatment of
these cells with curcumin, which inhibited Stat3 phosphorylation, resulted in reduction of the
NNMT level. They also , found a correlation between the expression of NNMT and activated
Stat3 in the colon cancer tissues. They concluded that NNMT is a novel Stat -3 regulated gene,
its expression is enhanced with the activation of Stat-3 in colon cancer tissues and it may be a
potential candidate for a tumor marker (Tomida et al., 2008)
Therefore, NNMT could be a new, sensitive, and specific marker that aids in the detection
of colorectal cancer. However, these conclusions are based on the measurement of only a
limited number of patients. Further studies on larger patient cohorts in cluding relevant disease
controls are needed .
Concerning urinary 8 -OHdG , which is an indicator of oxidative damage of DNA
(Płachetka et al., 2013) , we found that its preoperative levels in CRC patients (54.48±10.22
ng/mg creatinine) were significantly hig her than control group (9.80±13.83 ng/mg creatinine )
and these levels decreased significantly after 6 months of operation and treatment to reach
(31.07±13.83 ng/mg creatinine) . Urinary 8 -OHdG levels after 6 months of operation and
treatment in recurrent ca ses were significantly higher than non recurrent cases. Also, the
preoperative urinary 8 -OHdG levels in recurrent cases were higher than those in non recurrent
cases but with no significant statistical difference. Results concerning recurrent cases did not
reach statistical significance level due to small sample size (3 cases). Using 37.46 ng/mg

17 creatinine level as a cutoff value for urinary 8 -OHdG in our study, it showed 100% sensitivity
but it is non -specific for CRC.
Our results agreed with those of Kondo et al. (1999) who studied the presence of
oxidative stress in human colorectal adenocarcinomas and adenomas to determine whether
there is an association between oxidative stress and cellular proliferation. Higher levels of
oxidative modifications in DNA and proteins were observed in carcinoma cells, but not in
adenoma cells, than in the corresponding non -tumorous epithelial cells by
immunohistochemistry as well as high -performance liquid chromatography (HPLC) -based 8 –
OHdG determination. They concluded that colorectal carcinoma, but not adenoma cells, are
exposed to more oxidative stress than their corresponding non -tumorous epithelial cells,
regardless of clinical stage and histology, and further that the oxidative stress in carcinoma
cells might stimu late cellular proliferation .(Kondo et al., 1999)
Our results also agreed with those of Mei et al. (2005) who developed two sensitive
methods —capillary electrophoresis with electrochemical detection (CE -ECD) and gas
chromatography/mass spectrometry (GC/MS) for urinary 8 -OHdG analysis. They also ,
investigated the urinary 8 -OHdG levels in different cancer patients and follow up the response
of therapy. They found that the excretion levels of urinary 8OHdG in cancer patients were
significantly higher than those in healthy persons, and cancer patients receiving surgical
therapy and chemotherapy showed a significant decrease in urinary 8OHdG.
Our results are also , in agreement with the results of Hsu et al., (2009) who measured the
levels of modified nucleosides including 8 -OHdG in urine fr om 26 patients with CRC and 18
healthy controls by high performance liquid chromatography -electrospray/tandem mass
spectrometry. They found that the mean levels of urinary 8 -OHdG was significantly higher in
the patients with CRC than in healthy controls.
On the other hand, our results showed that raised 8 -OHdG levels are non -specific to CRC .
This agrees with that of Cooke et al., (2000) who considered urinary 8 -OHdG to be an
important biomarker of generalized, cellular oxidative stress and a DNA repair product in
urine. Different studies confirmed the rise of urinary 8 -OHdG level in different types of
diseases and cancers as in diabetes (Kanauchi et al., 2002) , breast cancer (Matsui et al.,
2000) , small cell lung cancer (Erhola e t al., 1997) and bladder and prostate cancers (Chiou et
al., 2003) . It appears that urinary 8 -OHdG is useful as a general marker for cancer risk.
Stool testing, unlike other conventional screening approaches, is noninvasive and requires
no cathartic preparation. However, widely used fecal blood tests yield frequent false -negative
and false -positive results that lower screening effectiveness and raise program costs
(Kalimutho et al., 2011) . Several characteristics of stool DNA testing would appear to
enhance screening participation. In contrast to FOB test screening, neither diet nor medication
restrictions would be required with fecal DNA testing. Further, a single stool may be
sufficient with DNA testing owing to the continuous release of exfoliated m arkers, and longer
screening intervals may be possible with fecal DNA testing because precursor adenomas as
well as cancers are detected. Preliminary cost -effectiveness modeling suggests favorable
incremental value over conventional screening approaches (Ahlquist and Shuber, 2002) . In
the current study, the efficacy of fecal L – DNA as a potential marker for CRC screening was
demonstrated. Longer template DNA is an epigenetic phenomenon that is consistent with the
known abrogation of apoptosis that occurs wi th CRC ( Zhang et al., 2015).

18 In the present study, most of patients were presented very late with severe constipation
that no stool sample could be taken. Only 20 out of the 50 CRC patients could give stool
samples. In our study, FOB had 90% sensitivity a nd 90% specificity and L -DNA had 95%
sensitivity and 90% specificity.
These results are in accordance with the results of Zou et al., (2006) who developed a
real-time Alu PCR assay for quantifying long human DNA in stool . Long DNA levels were
determined in blinded fashion from 18 CRC patients and 20 colonoscopically normal
controls. Human long DNA was quantifiable in all stools but was significantly higher in
stools from CRC patients than from normal controls (P < 0.05) . When human long DNA in
stool was used as a marker at a 100% specificity cutoff, about half of CRC patients could be
detected, which is consistent with the performance of long DNA as a marker in earlier reports
(Ahlquist et al., 2000 a & Calistri et al., 2003 ). The abundance of human long DNA in
stools from CRC patients likely reflects the non -apoptotic exfoliation that occurs with CRC .
Also, Zou et al., (2006) demonstrated that L -DNA is degraded with fecal storage, and
measures to stabilize th at analyte m ust be considered for optimal use of th at marker.
These results are also consistent with the report of Boynton et al. (2003) who purified
DNA from the stools of a colonoscopy -negative control group and patients with CRC and
examined the relationship betwee n long DNA fragments and clinical status by determining
stool DNA integrity, using oligonucleotide -based hybrid captures with specific target
sequences in increasingly long PCR reactions (200 bp, 400 bp, 800 bp, 1.3 kb, 1.8 kb, 24 kb).
DNA fragments obtain ed from CRC patients were compared with fragments obtained from
colonoscopy -negative individuals for length and/or integrity. DNA fragments isolated from
CRC patients were of higher molecular weight than fragments isolated from fecal DNA of the
colonoscopy -negative control group. They concluded that the presence of long DNA
fragments in stool is associated with CRC and an assay of fecal DNA integrity may be a
useful biomarker for the detection of CRC.
Our results are not matching with the results of Imperi ale et al. (2004) who made a
study to compare a panel of fecal DNA markers and Hemoccult II as screening tests for
colorectal cancer in an average -risk, asymptomatic population. The fecal DNA panel
consisted of 21 mutations including a marker of long DNA t hought to reflect disordered
apoptosis of cancer cells sloughed into the colonic lumen. The sensitivity of the fecal DNA
panel was four times that of Hemoccult II for invasive cancer and more than twice as sensitive
for adenomas containing high -grade dyspl asia. This increase in sensitivity was achieved
without a loss of specificity among persons with no polyps on colonoscopy. On the other
hand, in their study, the sensitivity of the long -DNA assay component was lower than
expected, a finding that may be rel ated to DNA degradation. This discrepancy seems to be
due to degradation by bacterial DNAases during prolonged pre -assay fecal storage that
occurred with mailed -in samples in these studies. Experimental observations in many studies
(Olson et al., 2005 & Zou et al., 2006) confirmed the instability of human long DNA during
fecal storage. Such degradation can be prevented by mixing stools with buffers containing a
DNAase inhibitor like EDTA (Olson et al., 2005 ). If human long DNA is to be used
clinically as a fecal marker, then attention must be given to incorporating a DNAase inhibitor
as part of specimen collection and processing.

19 Our results are in agreement with those of Kalimutho et al., (2011) who evaluated the
sensitivity and specificity of fecal -based DNA integrity versus immunological fecal occult
blood test (iFOBT) and calprotectin for colorectal cancer (CRC) and adenoma detection.
DNA integrity was quantified by quantitative -denaturing high performance liquid
chromatography. They found that L -DNA oc currence in feces has a sensitivity of 86% and a
specificity of 81% for CRC detection. They concluded that fecal DNA integrity assay is a
useful non -invasive, easy -to-perform, and reproducible method with a high level of sensitivity
in detecting individual s with colorectal neoplasia (Kalimutho et al., 2011)
Also , our results are matching with those of Zhang et al., (2015) who assayed L -DNA
based on PCR of an 800 bp length amplicon of APC , KRAS , BRAF and p53 genes was
performed for CRC screening. The identification of L -DNA in feces was found to exhibit a
sensitivity of 56.2% and specificity of 96.3% for CRC detection. In addition, long DNA was
identified in the feces of 58/90 (64.4%) patients with distal CRC and 15/40 (37.5%) patients
with proximal CRC. They concluded that the detection of fecal L -DNA by PCR and
electrophoresis is a valid, feasible and inexpensive method for the identification of patients
with CRC, particularly in patients with distal CRC (Zhang et al., 2015)
Human long DNA is not specific for CRC. Preliminary reports suggest that human long
DNA in stool may detect cancers in the upper gastrointestinal trac t as well (Ahlquist et al.,
2000b ). Inflammatory bowel disease has also , been shown to b e associated with elevated
levels of human long DNA in stools. In contrast to normal epithelial cells, which undergo
apoptosis when shed from their basement membrane attachment, inflammatory cells are
anchorage independent and logically contribute to long DNA in stools. (Shanmugathasan
and Jothy, 2000)
Stool L -DNA may be a useful marker for detection of CRC , but the discriminant value of
human long DNA measured by th at method would need to be verified in a larger and more
representative sample if it were to be considered for screening or other clinical applications.
Further optimization of the long DNA assay in combination with other methods including
FOBT and other sto ol DNA tests are needed for future clinical use. In addition, further studies
of long DNA assays for the identification of patients with advanced adenoma are also
required.
Conclusion:
Serum Desmin level, plasma NNMT activity , urinary 8 -OHdG and detection of L-DNA
in stools could serve as new diagnostic markers for CRC. Also, serum desmin level, plasma
NNMT activity and urinary 8 -OHdG are probably good prognostic markers for CRC. Larger
cohort studies are needed to confirm these results. Additionally, these studies need to address
the most important question of whether sensitivity for colorectal cancer could still be
increased by the combination of different markers for the disease.
REFERENCES:
Ahlquist, D. A., & Shuber, A. P. (2002): Stool screening for colorectal cancer: evolution
from occult blood to molecular markers. Clinica Chimica Acta 315(1 : 157-68.
Ahlquist, D. A., Skoletsky, J. E., Boynton, K. A., Harrington, J. J., Mahoney, D. W.,
Pierceall, W. E., … & Shuber, A. P. (2000a ): Colorectal cancer screening by detection of
altered human DNA in stool: feasibility of a multitarget assay panel. Gastroenterology 119(5)
:1219 -27.

20 Ahlquist, D. A., Cameron, A. J., Jett, J., Pearson, R. K., deGroen, P. C., Edell, E. S., … &
Shuber, A. (2000b): Universal detection of aerodigestive cancers by assay of non -apoptotic
human DNA in stool. Gastroenterology, 118(4) : A855.
Aksoy, S., Szumlanski, C. L., & Weinshilboum, R. M. (1994): Human liver nicotinamide
N-methyltransferase. cDNA cloning, expression, and biochemical characterization. J . Biol.
Chem ., 269(20) : 14835 -40.
Aksoy, S., Brandriff, B. F., Ward, A., Little, P. F., & Weinshilboum, R. M. (1995):
Human Nicotinamide< i> N</i> -Methyltransferase Gene: Molecular Cloning, Structural
Characterization and Chromosomal Loca lization. Genomics 29(3) : 555-61.
Arentz, G., Chataway, T., Price, T. J., Izwan, Z., Hardi, G., Cummins, A. G., &
Hardingham, J. E. (2011): Desmin expression in colorectal cancer stroma correlates with
advanced stage disease and marks angiogenic microvessels. Clin Proteomics 8(1) : 16-16.
Atkin W, Dadswell E, Wooldrage K, Kralj -Hans I, von Wagner C, Edwards R, Yao G, Kay C,
Burling D, Faiz O, Teare J, Lilford RJ, Morton D, Wardle J, Halligan S; SIGGAR
investigators (2013): Computed tomographic colonography versus colonoscopy for
investigation of patients with symptoms suggestive of colorectal cancer (SIGGAR): a
multicentre randomi zed trial. The Lancet; 381 (9873): 1194 -202.
Bär, H., Strelkov, S. V., Sjöberg, G., Aebi, U., & Herrmann, H. (2004): The biology of
desmin filaments: how do mutations affect their structure, assembly, and organi zation?. J
Structural Biology, 148(2), 137 -52.
Boynton, K. A., Summerhayes, I. C., Ahlquist, D. A., & Shuber, A. P. (2003): DNA
integrity as a potential marker for stool -based detection of colorectal cancer. C linical
Chemistry 49(7) : 1058 -65.
Calistri, D., Rengucci, C., Bocchini, R., Saragoni, L., Zoli, W., & Amadori, D. (2003):
Feca l multiple molecular tests to detect colorectal cancer in stoo l. Clin. Gastroenterol.
Hepatol ., 1(5): 377-83.
Cavia -Saiz, M., Rodríguez, P. M., Ayala, B. L., García -González, M., Coma -del Corral,
M. J., & Girón, C. G. (2014): The role of plasma IDO activity as a diagnostic marker of
patients with colorectal cancer. Molecula r Biol Repor., 41(4) : 2275 -9.
Chang, D., Wang, F. A. N., Zhao, Y. S., & Pan, H. Z. (2008): Evaluation of oxidative stress
in colorectal cancer patients. Bio medical and Envi ronmental Sciences 21(4) : 286-9.
Chiou, C. C., Chang, P. Y., Chan, E. C., Wu, T. L., Tsao, K. C., & Wu, J. T. (2003):
Urinary 8 -hydroxydeoxyguanosine and its analogs as DNA marker of oxidative stress:
development of an ELISA and measurement in both bladder and prostate cancers. Clinica
Chimica Acta 334(1): 87-94.
Cooke, M. S., Lunec, J., & Evans, M. D. (2002): Progress in the analysis of urinary
oxidative DNA damage. Free Rad . Biol.Med., 33(12) : 1601 -14.
Dauer DJ1, Ferraro B , Song L , Yu B , Mora L , Buettner R , Enkemann S , Jove R , Haura
EB. (2005): Stat3 regulates genes common to both wound healing and cancer. Oncogene
24(21) : 3397 -408.
Debigaré R1, Maltais F , Côté CH , Michaud A , Caron MA , Mofarrahi M , Leblanc P ,
Hussain SN (2008): Profiling of mRNA expression in quadriceps of patients with COPD and
muscle wasting. COPD: J Chr . Obstr . Pul. Dis., 5(2), 75 -84.

21 Elsabah MT, Adel I (2013): Immunohistochemical assay for detection of K -ras protein
expression in metastatic colorectal cancer. J Egypt Natl. Canc Instit ., 25(1): 51–6.
Erhola M1, Toyokuni S , Okada K , Tanaka T , Hiai H , Ochi H , Uchida K , Osawa T , Nieminen
MM, Alho H , Kellokumpu -Lehtinen P . (1997): Biomarker evidence of DNA oxidation in
lung cancer patients: association of urinary 8 -hydroxy -2′-deoxyguanosine excretion with
radiotherapy, chemotherapy, and response to treatment. FEBS letters , 409(2): 287-91.
Gado A, Ebeid B, Abdelmohsen A, Axon A (2014): Colorectal cancer in Egypt is
commoner in young people: Is this cause for alarm? Alexandria Journal of Medicine 50 (3):
197-201.
Hawk ET & Levin B (2005): Colorectal cancer prevention. J . Clin Oncol .. 23(2) : 378-91.
Hendrix MJ , Seftor EA, Seftor RE , Kasemeier -Kulesa J, Kulesa P M, & Postovit LM
2007): Reprogramming metastatic tumor cells with embryonic microenvironments. Nat Rev
Cancer 7(4) : 246-55.
Hsu WY , Chen WT, Lin WD , Tsai FJ , Tsai Y , Lin CT , Lo WY , Jeng LB , Lai CC .
(2009): Analysis of urinary nucleosides as potential tumor markers in human colorectal
cancer by high performance liquid chromatography/electrospray ionization tandem mass
spectrometry. Clin Chim Acta 402(1 -2): 31-7.
Imperiale, T. F., Ransohoff, D. F., Itzkowitz, S. H., Turnbull, B. A., & Ross, M. E.
(2004): Fecal DNA versus fecal occult blood for colorectal -cancer screening in an average –
risk population. N Engl J Med., 351(26) : 2704 -14.
Imperiale TF, Ransohoff DF, Itzkowitz SH, Levin TR, Lavin P, Lidgard GP, Ahlquist
DA, Berger BM (2014): Multitarget stool DNA testing for colorectal -cancer screening. N
Engl J Med ., 370(14) : 1287 -97.
Inaba, Y., Koide, S., Yokoyama, K., & Karube, I. (2011): Development of urinary 8 –
hydroxy -2'-deoxyguanosine (8 -OHdG) measurement method combined with SPE. J.
chrom atogr . Sci., 49(4) : 303-9.
Jiang W, Li X, Rao S, Wang L, Du L, Li C, Wu C , Wang H, Wang Y, Yang B.. (2008):
Constructing disease -specific gene networks using pair -wise relevance metric: application to
colon cancer identifies interleukin 8, desmin and enolase 1 as the central elements. BMC
Systems Biol., 2(1) : 72.
Kalimutho M, Del Vecchio Blanco G, Cretella M, Mannisi E, Sileri P, Formosa A,
Pallone F, Federici G, Bernardini S (2011): A simplified, non -invasive fecal -based DNA
integrity assay and iFOBT for colorectal cancer detection. Int j Colorectal Dis., 26(5) : 583-
92.
Kanauchi, M., Nishioka, H., & Hashimoto, T. (2002): Oxidative DNA damage and
tubulointerstitial injury in diabetic nephropathy. Nephron 91(2): 327-9.
Kariya, Y., Kato, K., Hayashizaki, Y., Himeno, S., Tarui, S., & Matsubar, K. (1987):
Revision of consensus sequence of h uman Alu repeats —a review. Gene 53(1) : 1-10.
Kim J , Hong SJ , Lim EK , Yu YS , Kim SW , Roh JH , Do IG , Joh JW , Kim DS . (2009):
Expression of nicotinamide N -methyltransferase in hepatoce llular carcinoma is associated
with poor prognosis. J Exp Clin Cancer Res ., 28(1) : 20
Kobayashi DT , Olson RJ , Sly L , Swanson CJ , Chung B , Naryshkin N , Narasimhan J ,
Bhattacharyya A , Mullenix M , Chen KS . (2011): Utility of survival motor neuron ELISA for
spinal muscular atrophy clinical and preclinical analyses. PloS one, 6(8) : e24269.

22 Kondo, S., Toyokuni, S., Iwasa, Y., Tanaka, T., Onodera, H., Hiai, H., & Imamura, M.
(1999): Persistent oxidative stress in human colorectal carcinoma, but not in adenoma. Free
Rad Biol Med., 27(3) : 401-10.
Kryston, T. B., Georgiev, A. B., Pissis, P., & Georgakilas, A. G. (2011): Role of oxidative
stress and DNA damage in human carcinogenesis. Mutation Research/Fundamental and
Molecular Mechanisms of Mutagenesis , 711(1), 193 -201.‏
Launois R , Le Moine JG , Uzzan B , Fiestas Navarr ete LI , Benamouzig R . (2014):
Systematic review and bivariate/HSROC random -effect meta -analysis of immunochemical
and guaiac -based fecal occult blood tests for colorectal cancer screening . Eur J Gastroenterol
Hepatol. 2014 Sep;26(9):978 -89
Lee NP , Leung KW , Cheung N , Lam BY , Xu MZ , Sham PC , Lau GK , Poon RT , Fan ST ,
Luk JM . (2008): Comparative proteomic analysis of mouse livers from embryo to adult
reveals an association with progression of hepatocellular carcinoma. Proteomics 8(10) : 2136 –
49.
Li, Z., Colucci -Guyon, E., Pinçon -Raymond, M., Mericskay, M., Pournin, S., Paulin, D.,
& Babinet, C. (1996): Cardiovascular lesions and skeletal myopathy in mice lacking desmin.
Deve lop. Biol., 175(2): 362-6.
Liegl, B., Hornick, J. L., Antonescu, C. R., Corless, C. L., & Fletcher, C. D. (2009):
Rhabdomyosarcomatous differentiation in gastrointestinal stromal tum ors after tyrosine
kinase inhibitor therapy: a novel form of tumor progression. Am J Surg Pathol ., 33(2) : 218-
26.
Lim, B., Cho, B., Kim, Y. N., Kim, J. W., Park, S., & Lee, C. (2006): Over -expression of
nicotinamide N -methyltransferase in gastric cancer ti ssues and its potential post -translational
modification. Exp Mol Med., 38(5) : 455.
Ma Y , Peng J , Liu W , Zhang P , Huang L , Gao B , Shen T , Zhou Y , Chen H , Chu Z ,
Zhang M , Qin H .. (2009): Proteomics identification of desmin as a potential onco -fetal
diagnostic and prognostic biomarker in colorectal cancer. Mol C ell Proteom 8(8) : 1878 -90.
Markert JM , Fuller CM , Gillespie GY , Bubien JK , McLean LA , Hong RL , Lee K ,
Gullans SR , Mapstone TB , Benos DJ . (2001): Differential gene expression profiling in
human brain tumors. Phys Genom ., 5(1): 21-33.
Mateuszuk Ł , Khomich TI , Słomińs ka E , Gajda M , Wójcik L , Łomnicka M , Gwóźdź P ,
Chłopicki S . (2009): Activation of nicotinamide N -methyltrasferase and increased formation
of 1-methylnicotinamide (MNA) in ath erosclerosis. Pharmacological Reports, 61(1) : 76-85.
Matsui A , Ikeda T , Enomoto K , Hosoda K , Nakashima H , Omae K , Watanabe M , Hibi
T, Kitajima M . (2000): Increased formation of oxidative DNA damage, 8 -hydroxy -2′-
deoxyguanosine, in human breast cancer tissue and its relationship to GSTP1 and COMT
genotypes . Cancer letters 151(1): 87-95.
Mei, S., Yao, Q., Wu, C., & Xu, G. (2005): Determination of urinary 8 -hydroxy -2′-
deoxyguanosine by two approaches —capillary electrophoresis and GC/MS: an assay for in
vivo oxidative DNA damage in cancer patients. J Chromatog .,B 827(1) : 83-7.
Mullis, K. B., Erlich, H. A., Arnheim, N., Horn, G. T., Saiki, R. K., & Scharf, S. J.
(1987): U.S. Patent No. 4,683,195. Washington, DC: U.S. Patent and Trademark Office.

23 Olson, J., Whitney, D. H., Durkee, K., & Shuber, A. P. (2005): DNA stabilization is
critical for maximizing performance of fecal DNA -based co lorectal cancer tests. Diagn Mol
Pathol ., 14(3): 183-91.
Płachetka, A., Adamek, B., Strzelczyk, J. K., Krakowczyk, Ł., Migula, P., Nowak, P., &
Wiczkowski, A. (2013): 8-hydroxy -2′-deoxyguanosine in colorectal adenocarcinoma –is it a
result of oxidative stress?. Med Sci Monit., 19: 690- 5..
Pozzi V , Sartini D , Morganti S , Giuliante R , Di Ruscio G , Santarelli A , Rocchetti R ,
Rubini C , Tomasetti M , Giannatempo G , Orlando F , Provinciali M , Lo Muzio L ,
Emanuelli M . (2013). RNA -mediated gene silencing of nicotinamide N -Methyltransferase is
associated with decreased tumorigenicity in human oral carcinoma cells. PloS one, 8(8) :
e71272
Quintero, E., Gimeno -García, A. Z., & Salido, E. (2010): Blood t ests for early detection of
colorectal cancer. Current Colorectal Cancer Reports, 6(1): 30-7
Roeβler M, Rollinger W , Palme S , Hagmann ML , Berndt P , Engel AM , Schneidinger B ,
Pfeffer M , Andres H , Karl J , Bodenmüller H , Rüschoff J , Henkel T , Rohr G , Rossol S , Rösch
W, Langen H , Zolg W , Tacke M . (2005): Identificati on of nicotinamide N -methyltransferase
as a novel serum tumor marker for colorectal cancer. Clin Cancer Res., 11(18) : 6550 -7.
Rogers CD , Fukushima N , Sato N , Shi C , Prasad N , Hustinx SR , Matsubayashi H , Canto M ,
Eshleman JR , Hruban RH , Goggins M .. (2006): Resea rch paper differentiating pancreatic
lesions by microarray and qPCR analysis of pancreatic juice RNAs. Cancer Biol. Ther 5(10) :
1383 -9.
Sano, A., Takimoto, N., & Takitani, S. (1989): Fluorometric assay of nicotinamide
methyltransferase with a new substrate, 4 -methylnicotinamide. Chem Pharmaceu t Bull.,
37(12) : 3330 -2.
Sartini, D., Muzzonigro, G., Milanese, G., Pierella, F., Rossi, V., & Emanuelli, M. (2006):
Identification of nicotina mide N -methyltransferase as a novel tumor marker for renal clear
cell carcinoma. J Urol., 176(5) : 2248 -54.
Sartini D, Santarelli A, Rossi V, Goteri G, Rubini C, Ciavarella D, Lo Muzio L, Emanuelli
M. (2007): Nicotinamide N -methyltransferase up -regulation inversely correlates with lymph
node metastasis in oral squamous cell carcinoma. Mol Med, 13(7 -8), 415 -21.
Shanmugathasan, M . & Jothy, S . (2000) : Apoptosis, anoikis and their relevance to the
pathobiology of colon cancer. Pathol Int. ;50(4): 273-9.
Stracci, F., Zorzi, M., & Grazzini, G. (2014): Colorectal cancer screening: Tests, strategies ,
and p erspectives. Front Public Health, 2 (210) 1-9..
Strater, J., Wedding, U. L. R. I. C. H., Barth, T. F., Koretz, K. A. R. I. N., Elsing, C. H.
R. I. S. T. O. P. H., & Moller, P. E. T. E. R. (1996). Rapid onset of apoptosis in vitro
follows disruption of beta 1 -integrin/matrix interactions in hu man colonic crypt cells.
Gastroenterol., 110(6): 1776 -84.
Struck W, Waszczuk -Jankowska M, Kaliszan R, Markuszewski MJ (2011): The state -of-
the-art determination of urinary nucleosides using chromatographic techniques ―hyphenated‖
with advanced bioinformat ic methods. Anal Bioanal Chem ., 401(7) : 2039 –50.
Tang, S. W., Yang, T. C., Lin, W. C., Chang, W. H., Wang, C. C., Lai, M. K., & Lin, J.
Y. (2011): Nicotinamide N -methyltransferase induces cellular invasion through activating

24 matrix metalloproteinase -2 expr ession in clear cell renal cell carcinoma cel ls. Carcinogenesis
32(2) : 138-45.
Thomas, P., Toth, C. A., Saini, K. S., Milburn Jessup, J., & Steele Jr, G. (1990): The
structure, metabolism and function of the carcinoembryonic antigen gene family. Biochimica
et Biophysica Acta (BBA) -Reviews on Cancer, 1032(2): 177-89.
Tomida, M., Ohtake, H., Yokota, T., Kobayashi, Y., & Kurosumi, M. (2008): Stat3 up –
regulates expression of nicotinamide N -methyltransferase in human cancer cells. J Cancer Res
Clin Oncol., 134(5) : 551-9.
Tomida, M., Mikami, I., Takeuchi, S., Nishimura, H., & Akiyama, H. (2009): Serum
levels of nicotinamide N -methyltransferase in patients with lung cancer. J Cancer Res Clin
Oncol., 135(9) : 1223 -9.
van Dam L, de Wijkerslooth TR, de Haan MC, S toop EM, Bossuyt PM, Fockens P,
Thomeer M, Kuipers EJ, van Leerdam ME, van Ballegooijen M, Stoker J, Dekker E,
Steyerberg EW (2013): Time requirements and health effects of participation in colorectal
cancer screening with colonoscopy or computed tomograph y colonography in a randomized
controlled trial. Endoscopy 45(3) : 182-8.
Williams, D. R., & Rapley, R. (2000): Agarose gel electrophoresis of nucleic acids. In The
nucleic acid protocols handbook (pp. 67 -70). Humana Press.
Wu, Y., Siadaty, M. S., Berens, M. E., Hampton, G. M., & Theodorescu, D. (2008):
Overlapping gene expression profiles of cell migration and tumor invasion in human bladder
cancer identify metallothionein 1E and nicotinamide N -methyltransferase as novel reg ulators
of cell migr ation. Oncogene 27(52) : 6679 -89.
Xie X, Yu H, Wang Y, Zhou Y, Li Ga, Ruan Z, Li Fa, Wang X, Liu H, Zhang J ,.
(2014): Nicotinamide N -methyltransferase enhances the capacity of tumorigenesis associated
with the promotion of cell cycle progression in human colorectal cancer cells. Archives of
Biochem Biophys ., 564: 52-66.
Xu, J., Capezzone, M., Xu, X., & Hershman, J. M. (2005): Activation of nicotinamide N –
methyltransferase gene promoter by hepatocyte nuclear factor -1β in human papillary thyroid
cancer cells. Mol Endocrinol ., 19(2) : 527-39.
Zhang Y , Suehiro Y , Shindo Y , Sakai K , Hazama S , Higaki S , Sakaida I , Oka M ,
Yamasaki T (2015): Long -fragment DNA as a potential marker for stool -based detection of
colorectal cance r. Oncology Letters 9(1) : 454–8.
Zou, H., Harrington, J. J., Klatt, K. K., & Ahlquist, D. A. (2006): A sensitive method to
quantify human long DNA in stool: relevance to colorectal cancer screening. Cancer
Epidemiol Biomark ers Prev., 15(6), 1115 -9.

25 اٌٍّخض اٌعشتٟ
دساسح و١ّ١ائ١ح ح١ٛ٠ح عٓ تعغ اٌذالالخ فٟ ِشع سشؽاْ اٌمٌْٛٛ ٚ اٌّسرم١ُ
شش٠ا اٌذ٠ة1 , أِأٟ أٚساِٗ1 , دعاء ٚد٠ع ِىس١ّٛط2 , عصّاْ دمحم عظاَ1 , ِا٠ىً عفد فخشٞ1
1 لسُ اٌى١ّ١اء اٌح١ٛ٠ح اٌطث١ح– وٍ١ح اٌطة 2 لسُ ظشاحح األٚساَ– ِعٙذ ظٕٛب ِظش ٌألٚساَ – ظاِعح
أس١ٛؽ
٠عذ ِشع سشؽاْ اٌمٌْٛٛ ٚ اٌّسرم١ُ شاٌس سشؽاْ عاٌّ١اً ِٓ ح١س وصشج حذٚشٗ تعذ سشؽاْ اٌشئح ٚ
اٌصذٞ ٚ فٟ ِظش ٠ّصً سشؽاْ اٌمٌْٛٛ ٚ اٌّسرم١ُ 5 % ِٓ وً حاالخ األٚساَ اٌسشؽأ١ح. ٠عرثش أخز
ع١ٕح ٌٍرحٍ١ً اٌثاشٌٛٛظٟ تاسرخذاَ ِٕظاس اٌمٌْٛٛ ٟ٘ اٌطش٠مح األدق ٌٍرشخ١ض عٍٝ اٌشغُ ِٓ وٛٔٙا
ؽش٠مح ِرعثح ٚ ِىٍفح ٌٍّش٠غ. ِٓ ٔاح١ح أخشٜ فئْ دالالخ األٚساَ اٌّسرخذِح حاٌ١اً ٟٚ٘ واسس١ٕٛ
اِثش٠ٛٔ١ه أر١ع١ٓ ٚ أر١ع١ٓ األٚساَ 19-9 لذ ظٙش ٔمض حساس١رٙا ٚ ذخظظٙا فٟ االورشاف اٌّثىش
ٚاٌّراتعح ٌسشؽاْ اٌمٌْٛٛ ٚاٌّسرم١ُ. وً ٘زٖ اٌحمائك أظٙشخ االحر١اض ٌٍثحس عٓ دالالخ أٚساَ أخشٜ
سٍٙح ٚدل١مح ٌٙزا اٌّشع ٌىٟ ٠سًٙ اورشاف اٌّشع فٟ اٌّشاحً األٌٚٝ اٌماتٍح ٌٍشفاء.
اٌذ٠سّٓ ٘ٛ تشٚذ١ٓ ٌٗ ٚظائف عذ٠ذج ٚ ٘ٛ أحذ اٌثشٚذ١ٕاخ اٌرٟ ذظٙش ِثىشاً ظذاً فٟ عؼالخ اٌعٕ١ٓ ٚ
ٌمذ أشثرد اٌذساساخ أٔٗ ٠ظٙش فٟ خال٠ا سشؽاْ اٌمٌْٛٛ ٚ اٌّسرم١ُ ٚ ٚظٛدٖ ٠رٕاسة ؽشد٠اً ِع ِذٜ
ذمذَ ِشحٍح اٌّشع.
االٔض٠ُ إٌالً ٌّعّٛعح اٌّص١ً إٌٝ ٔ١ىٛذ١ٕاِ١ذ ٠ٛظذ تشىً ؽث١عٟ فٟ اٌىثذ ٚ ٌىٓ لذ ذُ ِالحظح أٔٗ
٠ضداد ذىٛ٠ٕٗ ٚ ظٙٛسٖ ِع أِشاع ِخرٍفح ٚ سشؽأاخ ِخرٍفح ِٕٙا سشؽاْ اٌمٌْٛٛ ٚ اٌّسرم١ُ ٚ ٌمذ
ظٙش دٚسٖ األساسٟ فٟ ص٠ادج سشعح ّٔٛ اٌٛسَ ٚ ذمٍ١ً حذٚز اٌّٛخ اٌّثشِط ٌٍخال٠ا اٌسشؽأ١ح.
ذعرثش ذحاٌ١ً فحض اٌثشاص ِٓ اٌثذائً اٌّّراصج ٌٍّساعذج فٟ ذشخ١ض ِشػٝ سشؽاْ اٌمٌْٛٛ ٚ
اٌّسرم١ُ ألٔٙا ال ذسثة أٞ ِشىٍح ٌٍّش٠غ ٚ فٟ اٌعذ٠ذ ِٓ اٌذٚي فئْ فحض اٌثشاص ٚ اٌثحس عٓ ٚظٛد
دَ خفٟ ٘ٛ أحذ أُ٘ ٚسائً اورشاف اٌّشع ِثىشاً ٚ عٍٝ اٌشغُ ِٓ وْٛ ٘زا االخرثاس ِف١ذ ظذاً فٟ
االورشاف اٌّثىش ٌٍّشع ٌىٓ حساس١رٗ ٚ ذخظظٗ ٌٍّشع لٍ١ٍر١ٓ. ٠عشٞ اٌثحس ا٢ْ عٓ ذحاٌ١ً
فحض تشاص أخشٜ ِصً فحض اٌحّغ إٌٛٚٞ د٠ٛوسٟ س٠ثٛٔ١ىٍ١ه اسذ فٟ اٌثشاص؛ أحذ ٘زٖ االخرثاساخ
٘ٛ فحض اٌثشاص ٌٛظٛد أظضاء ؽٛ٠ٍح ِٓ اٌحّغ إٌٛٚٞ أوصش ِٓ 200 لاعذج ِضدٚظح ح١س أْ
اٌخال٠ا اٌطث١ع١ح ذرعشع ٌٍّٛخ اٌّثشِط ِّا ٠ؤدٞ أْ اٌحّغ إٌٛٚٞ اٌخاص تٙا ٠ظثح ؽٌٛٗ ألً ِٓ
200 لاعذج ِضدٚظح ٌىٓ اٌخال٠ا اٌسشؽأ١ح ال ٠حذز تٙا ِٛخ ِثشِط ِّا ٠ؤدٞ إٌٝ ظٙٛس حّغ
ٔٛٚٞ أؽٛي ِٓ 200 لاعذج ِضدٚظح فٟ تشاص ِشػٝ سشؽاْ اٌمٌْٛٛ ٚ اٌّسرم١ُ.
أ٠ؼاً ِٓ اٌّعشٚف أْ اٌخال٠ا ذرعشع دائّاً ٌألوسذج تسثة اٌعزٚس اٌحشج ِّا ٠ٕرط عٕٗ أوسذج
ٌٍذ٠ٛوسٟ س٠ثٛٔ١ىٍ١ه اسذ ِّا ٠ؤدٞ إٌٝ ذىٛ٠ٓ 8- ٘١ذسٚوسٟ د٠ٛوسٟ ظٛأٛس١ٓ, ٌزٌه ٠عرثش ٚظٛد
٘زٖ إٌ١ىٍ١ٛس١ذ دٌ١الً عٍٝ حذٚز ؽفشاخ ٚ ص٠ادج اٌرعشع ٌألٚساَ اٌسشؽأ١ح ٚ ٕ٘ان اٌعذ٠ذ ِٓ
اٌذساساخ اٌرٟ ستطد ت١ٓ ص٠ادج ٘زٖ إٌ١ىٍ١ٛس١ذ فٟ اٌذَ ٚ اٌثٛي ٚ حذٚز ِشع سشؽاْ اٌمٌْٛٛ ٚ
اٌّسرم١ُ.

26 ٌمذ لّٕا فٟ ٘زا اٌثحس ترم١١ُ ِذٜ حساس١ح ٚ ذخظض ٘زٖ اٌذالالخ اٌعذ٠ذج فٟ ذشخ١ض ِشع
سشؽاْ اٌمٌْٛٛ ٚ اٌّسرم١ُ ٚ ِراتعرٗ تعذ اٌعٍّ١ح الورشاف عٛدج اٌّشع ِثىشاً ٚ ٘زٖ اٌذالالخ اٌرٟ ذُ
اخرثاس٘ا ٟ٘ ل١اط ِسرٜٛ اٌذ٠سّٓ فٟ اٌّظً ٚ ل١اط ٔشاؽ االٔض٠ُ إٌالً ٌّعّٛعح اٌّص١ً إٌٝ
ٔ١ىٛذ١ٕاِ١ذ فٟ اٌثالصِا ٚ اٌثحس عٓ ٚظٛد أظضاء ؽٛ٠ٍح ِٓ اٌحّغ إٌٛٚٞ د٠ٛوسٟ س٠ثٛٔ١ىٍ١ه اسذ
أوصش ِٓ 200 لاعذج ِضدٚظح فٟ اٌثشاص ٚ ل١اط ِسرٜٛ8- ٘١ذسٚوسٟ د٠ٛوسٟ ظٛأٛس١ٓ فٟ اٌثٛي
فٟ ِعّٛعح ِٓ ِشػٝ سشؽاْ اٌمٌْٛٛ ٚ اٌّسرم١ُ لثً ٚ تعذ إظشاء اٌعٍّ١ح ٚ أخز اٌعالض ٚ ِماسٔح
ل١ُ ٘زٖ اٌذالالخ ِع ِعّٛعح ِٓ األطحاء وّعّٛعح ػاتطح.
ٌمذ ٚظذٔا أْ ِسرٜٛ اٌذ٠سّٓ فٟ اٌّظً ٚ ٔشاؽ االٔض٠ُ إٌالً ٌّعّٛعح اٌّص١ً إٌٝ ٔ١ىٛذ١ٕاِ١ذ فٟ
اٌثالصِا ٚ ِسرٜٛ 8- ٘١ذسٚوسٟ د٠ٛوسٟ ظٛأٛس١ٓ فٟ اٌثٛي ذضداد اصد٠ادا را دالٌح إحظائ١ح فٟ
ِشػٝ سشؽاْ اٌمٌْٛٛ ٚ اٌّسرم١ُ عٓ األشخاص اٌطث١ع١١ٓ ٚ ذٕخفغ ٘زٖ اٌذالالخ أخفاػا را دالٌح
إحظائ١ح تعذ إظشاء اٌعٍّ١ح ٚ أخز اٌعالض ٚ ذشذفع إٌسة تعذ اٌعٍّ١ح ٚ اٌعالض فٟ حاالخ عٛدج اٌّشع
ِّا ٠ذي عٍٝ أْ ٘زٖ اٌذالالخ ٠ّىٓ أْ ذىْٛ ِف١ذج فٟ ذشخ١ض ٚ ِراتعح ِشع سشؽاْ اٌمٌْٛٛ ٚ
اٌّسرم١ُ ٚ ٌمذ الحظٕا أ٠ؼاً ٚظٛد أظضاء ؽٛ٠ٍح ِٓ اٌحّغ إٌٛٚٞ د٠ٛوسٟ س٠ثٛصٞ (أوصش ِٓ 200
لاعذج ِضدٚظح) فٟ اٌثشاص فٟ 90 % ِٓ ِشػٝ سشؽاْ اٌمٌْٛٛ ٚ اٌّسرم١ُ ِّا ٠ذي عٍٝ اِىأ١ح أْ
٠سرخذَ ٘زا االخرثاس فٟ اٌرشخ١ض اٌّثىش ٌٙزا اٌّشع, ٚالسرخذاَ ٘زٖ اٌذالالخ عٍّ١اَ ٠ٕثغٟ إظشاء
أتحاز أوثش عٍٝ أعذاد أوصش ِٓ اٌّشػٝ خاطح فٟ ِشاحً ِثىشج ِٓ اٌّشع.‏